Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing nrfE gene

Properties
Regulog: NrfR - Bacteroidaceae
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrate and nitrite respiration
Effector: Nitrite
Phylum: Bacteroidetes
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Bacteroides fragilis NCTC 9343
Position: -73
Score: 6.13525
Sequence: AATGTAATCTGGATTACATC
Locus tag: BF0360
Name: nrfH
Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BF0361
Name: nrfA
Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BF0362
Name: nrfI
Funciton: Cytochrome c biogenesis protein
Locus tag: BF0363
Name: nrfE
Funciton: Cytochrome c biogenesis protein
Locus tag: BF0364
Name: nrfP
Funciton: Predicted porin, associated with nitrate respiration
Locus tag: BF0365
Name: nrfR
Funciton: Predicted transcriptional regulator of nitrite reductase, Crp family
nrfH-nrfA-nrfI-nrfE-nrfP-nrfR -73 6.1 AATGTAATCTGGATTACATC BF0360
Bacteroides ovatus ATCC 8483
Position: -65
Score: 6.42757
Sequence: GGTGTAATAGATATTACACC
Locus tag: BACOVA_00831
Name: nrfH
Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BACOVA_00830
Name: nrfA
Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BACOVA_00829
Name: nrfI
Funciton: Cytochrome c biogenesis protein
Locus tag: BACOVA_00828
Name: nrfE
Funciton: Cytochrome c biogenesis protein
Locus tag: BACOVA_00827
Name: nrfP
Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP -65 6.4 GGTGTAATAGATATTACACC BACOVA_00831
Bacteroides plebeius DSM 17135
Position: 27
Score: 6.01401
Sequence: GGTGTCATATTTATTACACC
Locus tag: BACPLE_01440
Name: nrfH
Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BACPLE_01441
Name: nrfA
Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BACPLE_01442
Name: nrfI
Funciton: Cytochrome c biogenesis protein
Locus tag: BACPLE_01443
Name: nrfE
Funciton: Cytochrome c biogenesis protein
Locus tag: BACPLE_01444
Name: nrfP
Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP 27 6 GGTGTCATATTTATTACACC BACPLE_01440
Bacteroides thetaiotaomicron VPI-5482
Position: -66
Score: 6.57031
Sequence: GGTGTAATAGTTATTACACC
Locus tag: BT1418
Name: nrfH
Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BT1417
Name: nrfA
Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BT1416
Name: nrfI
Funciton: Cytochrome c biogenesis protein
Locus tag: BT1415
Name: nrfE
Funciton: Cytochrome c biogenesis protein
Locus tag: BT1414
Name: nrfP
Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP -66 6.6 GGTGTAATAGTTATTACACC BT1418
Bacteroides uniformis ATCC 8492
Position: -64
Score: 6.5138
Sequence: AATGTAATCATGATTACACT
Locus tag: BACUNI_04432
Name: nrfH
Funciton: Cytochrome c nitrite reductase, small subunit NrfH
Locus tag: BACUNI_04431
Name: nrfA
Funciton: Cytochrome c552 precursor (EC 1.7.2.2)
Locus tag: BACUNI_04430
Name: nrfI
Funciton: Cytochrome c biogenesis protein
Locus tag: BACUNI_04429
Name: nrfE
Funciton: Cytochrome c biogenesis protein
Locus tag: BACUNI_04428
Name: nrfP
Funciton: Predicted porin, associated with nitrate respiration
nrfH-nrfA-nrfI-nrfE-nrfP -64 6.5 AATGTAATCATGATTACACT BACUNI_04432