Regulon of NrfR in Bacteroides fragilis NCTC 9343

Properties
Regulator type:	Transcription factor
TF locus tag:	BF0365
Regulator family:	CRP
Regulation mode:	activator
Biological process:	Nitrate and nitrite respiration
Effector:	Nitrite
Regulog:	NrfR - Bacteroidaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - CRP
By effector - Nitrite
By pathway - Nitrate and nitrite respiration

Regulated operons
	Locus Tag	Name	Function
Position: -73 Score: 6.1 Sequence: AATGTAATCTGGATTACATC Locus tag: BF0360 Name: nrfH Funciton: Cytochrome c nitrite reductase, small subunit NrfH Locus tag: BF0361 Name: nrfA Funciton: Cytochrome c552 precursor (EC 1.7.2.2) Locus tag: BF0362 Name: nrfI Funciton: Cytochrome c biogenesis protein Locus tag: BF0363 Name: nrfE Funciton: Cytochrome c biogenesis protein Locus tag: BF0364 Name: nrfP Funciton: Predicted porin, associated with nitrate respiration Locus tag: BF0365 Name: nrfR Funciton: Predicted transcriptional regulator of nitrite reductase, Crp family
	BF0360	nrfH	Cytochrome c nitrite reductase, small subunit NrfH
	BF0361	nrfA	Cytochrome c552 precursor (EC 1.7.2.2)
	BF0362	nrfI	Cytochrome c biogenesis protein
	BF0363	nrfE	Cytochrome c biogenesis protein
	BF0364	nrfP	Predicted porin, associated with nitrate respiration
	BF0365	nrfR	Predicted transcriptional regulator of nitrite reductase, Crp family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD