Regulog Lp_2742 - Lactobacillaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Statistics of regulated genes
Genome	Genes	Operons
Lactobacillus acidophilus NCFM
Lactobacillus brevis ATCC 367	3	1
Lactobacillus casei ATCC 334
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365
Lactobacillus fermentum IFO 3956	3	1
Lactobacillus helveticus DPC 4571
Lactobacillus johnsonii NCC 533
Lactobacillus plantarum WCFS1	6	1
Lactobacillus reuteri JCM 1112	3	1
Lactobacillus rhamnosus GG
Lactobacillus sakei subsp. sakei 23K	3	1
Lactobacillus salivarius subsp. salivarius UCC118	3	1
Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293
Oenococcus oeni PSU-1
Pediococcus pentosaceus ATCC 25745	6	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
lp_2739	Lactobacillus acidophilus NCFM Gene: LBA1680: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	* Lactobacillus brevis ATCC 367 Site: position = -46 score = 6.67078 sequence = TTAATTACACAAGTAACTAA Gene: LVIS_0387: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	Lactobacillus casei ATCC 334 Gene: LSEI_1994: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	2 Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0989: Predicted antimicrobial peptide ABC transporter, ATP-binding protein Gene: LBUL_1019: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_1774: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	Lactobacillus johnsonii NCC 533 Gene: LJ0604: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	* Lactobacillus plantarum WCFS1 Site: position = -59 score = 6.83482 sequence = TTAGTTACATAAGTAATTAA Gene: lp_2739: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_01986: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	Lactobacillus sakei subsp. sakei 23K Gene: LSA0127: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	* Pediococcus pentosaceus ATCC 25745 Site: position = -42 score = 6.67078 sequence = TTAGTTACACAAGTAATTAA Gene: PEPE_1743: Predicted antimicrobial peptide ABC transporter, ATP-binding protein	Predicted antimicrobial peptide ABC transporter, ATP-binding protein
lp_2740	Lactobacillus acidophilus NCFM Gene: LBA1679: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus brevis ATCC 367 Gene: LVIS_0388: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus casei ATCC 334 Gene: LSEI_1993: Predicted antimicrobial peptide ABC transporter, permease protein	2 Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0990: Predicted antimicrobial peptide ABC transporter, permease protein Gene: LBUL_1018: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571 Gene: lhv_1773: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus johnsonii NCC 533 Gene: LJ0605: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus plantarum WCFS1 Gene: lp_2740: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG Gene: LGG_01985: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus sakei subsp. sakei 23K Gene: LSA0128: Predicted antimicrobial peptide ABC transporter, permease protein	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1744: Predicted antimicrobial peptide ABC transporter, permease protein	Predicted antimicrobial peptide ABC transporter, permease protein
lp_2741	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_2741: Predicted integral membrane protein	Lactobacillus reuteri JCM 1112	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K	Lactobacillus salivarius subsp. salivarius UCC118	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745	Predicted integral membrane protein
lp_2742	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367 Gene: LVIS_0389: Transcriptional regulator, GntR family	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	* Lactobacillus fermentum IFO 3956 Site: position = -48 score = 6.67078 sequence = TTAGTTACACAAGTAATTAA Gene: LAF_1400: Transcriptional regulator, GntR family	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_2742: Transcriptional regulator, GntR family	* Lactobacillus reuteri JCM 1112 Site: position = -48 score = 6.4641 sequence = TTAGTTACATAAGTGATTAA Gene: LAR_1262: Transcriptional regulator, GntR family	Lactobacillus rhamnosus GG	* Lactobacillus sakei subsp. sakei 23K Site: position = -262 score = 6.4641 sequence = TTAACTACATAAGTAACTAA Gene: LSA0929: Transcriptional regulator, GntR family	* Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -52 score = 6.83482 sequence = TTAGTTACATAAGTAATTAA Gene: LSL_1617: Transcriptional regulator, GntR family	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	* Pediococcus pentosaceus ATCC 25745 Site: position = -61 score = 6.30006 sequence = TTAGTTACATGACTAATTAA Gene: PEPE_1308: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
lp_2743	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956 Gene: LAF_1399: ABC-type multidrug transport system, ATPase component	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_2743: ABC-type multidrug transport system, ATPase component	Lactobacillus reuteri JCM 1112 Gene: LAR_1261: ABC-type multidrug transport system, ATPase component	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K Gene: LSA0930: ABC-type multidrug transport system, ATPase component	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1616: ABC-type multidrug transport system, ATPase component	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1307: ABC-type multidrug transport system, ATPase component	ABC-type multidrug transport system, ATPase component
lp_2744	Lactobacillus acidophilus NCFM	Lactobacillus brevis ATCC 367	Lactobacillus casei ATCC 334	Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365	Lactobacillus fermentum IFO 3956 Gene: LAF_1398: ABC-type multidrug transport system, permease component	Lactobacillus helveticus DPC 4571	Lactobacillus johnsonii NCC 533	Lactobacillus plantarum WCFS1 Gene: lp_2744: ABC-type multidrug transport system, permease component	Lactobacillus reuteri JCM 1112 Gene: LAR_1260: ABC-type multidrug transport system, permease component	Lactobacillus rhamnosus GG	Lactobacillus sakei subsp. sakei 23K Gene: LSA0931: ABC-type multidrug transport system, permease component	Lactobacillus salivarius subsp. salivarius UCC118 Gene: LSL_1615: ABC-type multidrug transport system, permease component	Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293	Oenococcus oeni PSU-1	2 Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1305: ABC-type multidrug transport system, permease component Gene: PEPE_1306: ABC-type multidrug transport system, permease component	ABC-type multidrug transport system, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Lp_2742 - Lactobacillaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --