Regulog Lp_2742 - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug efflux; Multidrug resistance |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By pathway - Multidrug efflux
- By pathway - Multidrug resistance
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | 3 | 1 |
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | 3 | 1 |
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 6 | 1 |
| Lactobacillus reuteri JCM 1112 | 3 | 1 |
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | 3 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | 3 | 1 |
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 6 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| lp_2739 |
Gene: LBA1680: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
*
Lactobacillus brevis ATCC 367 Site: position = -46 score = 6.67078 sequence = TTAATTACACAAGTAACTAA Gene: LVIS_0387: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
Gene: LSEI_1994: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0989: Predicted antimicrobial peptide ABC transporter, ATP-binding protein Gene: LBUL_1019: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
|
Gene: lhv_1774: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
Gene: LJ0604: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
*
Lactobacillus plantarum WCFS1 Site: position = -59 score = 6.83482 sequence = TTAGTTACATAAGTAATTAA Gene: lp_2739: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
|
Gene: LGG_01986: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
Gene: LSA0127: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
|
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -42 score = 6.67078 sequence = TTAGTTACACAAGTAATTAA Gene: PEPE_1743: Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
Predicted antimicrobial peptide ABC transporter, ATP-binding protein |
| lp_2740 |
Gene: LBA1679: Predicted antimicrobial peptide ABC transporter, permease protein |
Gene: LVIS_0388: Predicted antimicrobial peptide ABC transporter, permease protein |
Gene: LSEI_1993: Predicted antimicrobial peptide ABC transporter, permease protein |
2
Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 Gene: LBUL_0990: Predicted antimicrobial peptide ABC transporter, permease protein Gene: LBUL_1018: Predicted antimicrobial peptide ABC transporter, permease protein |
|
Gene: lhv_1773: Predicted antimicrobial peptide ABC transporter, permease protein |
Gene: LJ0605: Predicted antimicrobial peptide ABC transporter, permease protein |
Gene: lp_2740: Predicted antimicrobial peptide ABC transporter, permease protein |
|
Gene: LGG_01985: Predicted antimicrobial peptide ABC transporter, permease protein |
Gene: LSA0128: Predicted antimicrobial peptide ABC transporter, permease protein |
|
|
|
Gene: PEPE_1744: Predicted antimicrobial peptide ABC transporter, permease protein |
Predicted antimicrobial peptide ABC transporter, permease protein |
| lp_2741 |
|
|
|
|
|
|
|
Gene: lp_2741: Predicted integral membrane protein |
|
|
|
|
|
|
|
Predicted integral membrane protein |
| lp_2742 |
|
Gene: LVIS_0389: Transcriptional regulator, GntR family |
|
|
*
Lactobacillus fermentum IFO 3956 Site: position = -48 score = 6.67078 sequence = TTAGTTACACAAGTAATTAA Gene: LAF_1400: Transcriptional regulator, GntR family |
|
|
Gene: lp_2742: Transcriptional regulator, GntR family |
*
Lactobacillus reuteri JCM 1112 Site: position = -48 score = 6.4641 sequence = TTAGTTACATAAGTGATTAA Gene: LAR_1262: Transcriptional regulator, GntR family |
|
*
Lactobacillus sakei subsp. sakei 23K Site: position = -262 score = 6.4641 sequence = TTAACTACATAAGTAACTAA Gene: LSA0929: Transcriptional regulator, GntR family |
*
Lactobacillus salivarius subsp. salivarius UCC118 Site: position = -52 score = 6.83482 sequence = TTAGTTACATAAGTAATTAA Gene: LSL_1617: Transcriptional regulator, GntR family |
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -61 score = 6.30006 sequence = TTAGTTACATGACTAATTAA Gene: PEPE_1308: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| lp_2743 |
|
|
|
|
Gene: LAF_1399: ABC-type multidrug transport system, ATPase component |
|
|
Gene: lp_2743: ABC-type multidrug transport system, ATPase component |
Gene: LAR_1261: ABC-type multidrug transport system, ATPase component |
|
Gene: LSA0930: ABC-type multidrug transport system, ATPase component |
Gene: LSL_1616: ABC-type multidrug transport system, ATPase component |
|
|
Gene: PEPE_1307: ABC-type multidrug transport system, ATPase component |
ABC-type multidrug transport system, ATPase component |
| lp_2744 |
|
|
|
|
Gene: LAF_1398: ABC-type multidrug transport system, permease component |
|
|
Gene: lp_2744: ABC-type multidrug transport system, permease component |
Gene: LAR_1260: ABC-type multidrug transport system, permease component |
|
Gene: LSA0931: ABC-type multidrug transport system, permease component |
Gene: LSL_1615: ABC-type multidrug transport system, permease component |
|
|
2
Pediococcus pentosaceus ATCC 25745 Gene: PEPE_1305: ABC-type multidrug transport system, permease component Gene: PEPE_1306: ABC-type multidrug transport system, permease component |
ABC-type multidrug transport system, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |