Regulon of Lp_2742 in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_1308
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Regulog:	Lp_2742 - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -42 Score: 6.7 Sequence: TTAGTTACACAAGTAATTAA Locus tag: PEPE_1743 Name: lp_2739 Funciton: Predicted antimicrobial peptide ABC transporter, ATP-binding protein Locus tag: PEPE_1744 Name: lp_2740 Funciton: Predicted antimicrobial peptide ABC transporter, permease protein
	PEPE_1743	lp_2739	Predicted antimicrobial peptide ABC transporter, ATP-binding protein
	PEPE_1744	lp_2740	Predicted antimicrobial peptide ABC transporter, permease protein
Position: -61 Score: 6.3 Sequence: TTAGTTACATGACTAATTAA Locus tag: PEPE_1308 Name: lp_2742 Funciton: Transcriptional regulator, GntR family Locus tag: PEPE_1307 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: PEPE_1306 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component Locus tag: PEPE_1305 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
	PEPE_1308	lp_2742	Transcriptional regulator, GntR family
	PEPE_1307	lp_2743	ABC-type multidrug transport system, ATPase component
	PEPE_1306	lp_2744	ABC-type multidrug transport system, permease component
	PEPE_1305	lp_2744	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD