Regulon of Lp_2742 in Lactobacillus brevis ATCC 367

Properties
Regulator type:	Transcription factor
TF locus tag:	LVIS_0389
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Regulog:	Lp_2742 - Lactobacillaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.7 Sequence: TTAATTACACAAGTAACTAA Locus tag: LVIS_0387 Name: lp_2739 Funciton: Predicted antimicrobial peptide ABC transporter, ATP-binding protein Locus tag: LVIS_0388 Name: lp_2740 Funciton: Predicted antimicrobial peptide ABC transporter, permease protein Locus tag: LVIS_0389 Name: lp_2742 Funciton: Transcriptional regulator, GntR family
	LVIS_0387	lp_2739	Predicted antimicrobial peptide ABC transporter, ATP-binding protein
	LVIS_0388	lp_2740	Predicted antimicrobial peptide ABC transporter, permease protein
	LVIS_0389	lp_2742	Transcriptional regulator, GntR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD