Regulon of Lp_2742 in Lactobacillus brevis ATCC 367
| Regulator type: | Transcription factor |
| TF locus tag: | LVIS_0389 |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Multidrug efflux; Multidrug resistance |
| Effector: | |
| Regulog: | Lp_2742 - Lactobacillaceae |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - GntR/Others
- By pathway - Multidrug efflux
- By pathway - Multidrug resistance
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -46
Score: 6.7 Sequence: TTAATTACACAAGTAACTAA
Locus tag: LVIS_0387
Name: lp_2739 Funciton: Predicted antimicrobial peptide ABC transporter, ATP-binding protein
Locus tag: LVIS_0388
Name: lp_2740 Funciton: Predicted antimicrobial peptide ABC transporter, permease protein
Locus tag: LVIS_0389
Name: lp_2742 Funciton: Transcriptional regulator, GntR family |
|||
|
lp_2739
|
Predicted antimicrobial peptide ABC transporter, ATP-binding protein
|
||
|
lp_2740
|
Predicted antimicrobial peptide ABC transporter, permease protein
|
||
|
lp_2742
|
Transcriptional regulator, GntR family
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |