Regulon of Lp_2742 in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_2742
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux; Multidrug resistance
Effector:
Regulog:	Lp_2742 - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - GntR/Others
By pathway - Multidrug efflux
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -59 Score: 6.8 Sequence: TTAGTTACATAAGTAATTAA Locus tag: lp_2739 Name: lp_2739 Funciton: Predicted antimicrobial peptide ABC transporter, ATP-binding protein Locus tag: lp_2740 Name: lp_2740 Funciton: Predicted antimicrobial peptide ABC transporter, permease protein Locus tag: lp_2741 Name: lp_2741 Funciton: Predicted integral membrane protein Locus tag: lp_2742 Name: lp_2742 Funciton: Transcriptional regulator, GntR family Locus tag: lp_2743 Name: lp_2743 Funciton: ABC-type multidrug transport system, ATPase component Locus tag: lp_2744 Name: lp_2744 Funciton: ABC-type multidrug transport system, permease component
	lp_2739	lp_2739	Predicted antimicrobial peptide ABC transporter, ATP-binding protein
	lp_2740	lp_2740	Predicted antimicrobial peptide ABC transporter, permease protein
	lp_2741	lp_2741	Predicted integral membrane protein
	lp_2742	lp_2742	Transcriptional regulator, GntR family
	lp_2743	lp_2743	ABC-type multidrug transport system, ATPase component
	lp_2744	lp_2744	ABC-type multidrug transport system, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD