Regulog IdnR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | activator (repressor) |
| Biological process: | Idonate utilization |
| Effector: | L-idonate; 5-dehydro-D-gluconate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By TF family - LacI
- By effector - L-idonate
- By effector - 5-dehydro-D-gluconate
- By pathway - Idonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Citrobacter koseri ATCC BAA-895 | 3 | 1 |
| Edwardsiella tarda EIB202 | ||
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Escherichia coli str. K-12 substr. MG1655 | 5 | 2 |
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 | ||
| Proteus mirabilis HI4320 | ||
| Salmonella typhimurium LT2 | 5 | 2 |
| Serratia proteamaculans 568 | 3 | 2 |
| Yersinia pestis KIM |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| idnK |
|
|
|
|
|
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -119 score = 5.87062 sequence = CTATGTTACGCATAACGTGA Gene: b4268: Gluconokinase (EC 2.7.1.12) |
|
|
|
*
Salmonella typhimurium LT2 Site: position = -119 score = 5.93303 sequence = CAATGTTACGCATAACGTGA Gene: STM4485: Gluconokinase (EC 2.7.1.12) |
|
Gene: y1646: Gluconokinase (EC 2.7.1.12) |
Gluconokinase (EC 2.7.1.12) |
| CRON 2. | |||||||||||||
| idnD |
|
|
|
|
|
*
Escherichia coli str. K-12 substr. MG1655 Site: position = -117 score = 5.87062 sequence = TCACGTTATGCGTAACATAG Gene: b4267: L-idonate 5-dehydrogenase (EC 1.1.1.264) |
|
|
|
*
Salmonella typhimurium LT2 Site: position = -117 score = 5.93303 sequence = TCACGTTATGCGTAACATTG Gene: STM4484: L-idonate 5-dehydrogenase (EC 1.1.1.264) |
Gene: Spro_3287: L-idonate 5-dehydrogenase (EC 1.1.1.264) |
|
L-idonate 5-dehydrogenase (EC 1.1.1.264) |
| idnO |
*
Citrobacter koseri ATCC BAA-895 Site: position = -39 score = 5.29997 sequence = TACAGTTACGCGTAACAGCT Gene: CKO_02793: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) |
|
|
|
|
Gene: b4266: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) |
|
|
|
Gene: STM4483: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) |
*
Serratia proteamaculans 568 Site: position = -121 score = 5.08153 sequence = TCACGTTAAAGGTAACAGCT Gene: Spro_3288: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) |
Gene: y1645: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) |
5-keto-D-gluconate 5-reductase (EC 1.1.1.69) |
| idnT |
|
|
|
|
|
Gene: b4265: L-idonate, D-gluconate, 5-keto-D-gluconate transporter |
|
|
|
Gene: STM4482: L-idonate, D-gluconate, 5-keto-D-gluconate transporter |
|
|
L-idonate, D-gluconate, 5-keto-D-gluconate transporter |
| idnR |
Gene: CKO_02791: Positive regulator of L-idonate catabolism |
|
|
|
|
Gene: b4264: Positive regulator of L-idonate catabolism |
|
|
|
Gene: STM4481: Positive regulator of L-idonate catabolism |
*
Serratia proteamaculans 568 Site: position = -169 score = 5.08153 sequence = AGCTGTTACCTTTAACGTGA Gene: Spro_3289: Positive regulator of L-idonate catabolism |
Gene: y1650: Positive regulator of L-idonate catabolism |
Positive regulator of L-idonate catabolism |
| CKO_02792 |
Gene: CKO_02792: 2-ketogluconate transporter |
|
|
|
|
|
|
|
|
|
|
|
2-ketogluconate transporter |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |