Regulon of IdnR in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM4481
Regulator family:	LacI
Regulation mode:	activator (repressor)
Biological process:	Idonate utilization
Effector:	L-idonate; 5-dehydro-D-gluconate
Regulog:	IdnR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - L-idonate
By effector - 5-dehydro-D-gluconate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -117 Score: 5.9 Sequence: TCACGTTATGCGTAACATTG Locus tag: STM4484 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264) Locus tag: STM4483 Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) Locus tag: STM4482 Name: idnT Funciton: L-idonate, D-gluconate, 5-keto-D-gluconate transporter Locus tag: STM4481 Name: idnR Funciton: Positive regulator of L-idonate catabolism
	STM4484	idnD	L-idonate 5-dehydrogenase (EC 1.1.1.264)
	STM4483	idnO	5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
	STM4482	idnT	L-idonate, D-gluconate, 5-keto-D-gluconate transporter
	STM4481	idnR	Positive regulator of L-idonate catabolism
Position: -119 Score: 5.9 Sequence: CAATGTTACGCATAACGTGA Locus tag: STM4485 Name: idnK Funciton: Gluconokinase (EC 2.7.1.12)
	STM4485	idnK	Gluconokinase (EC 2.7.1.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD