Regulon of IdnR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_02791
Regulator family:	LacI
Regulation mode:	activator (repressor)
Biological process:	Idonate utilization
Effector:	L-idonate; 5-dehydro-D-gluconate
Regulog:	IdnR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - L-idonate
By effector - 5-dehydro-D-gluconate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.3 Sequence: TACAGTTACGCGTAACAGCT Locus tag: CKO_02793 Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) Locus tag: CKO_02792 Name: null Funciton: 2-ketogluconate transporter Locus tag: CKO_02791 Name: idnR Funciton: Positive regulator of L-idonate catabolism
	CKO_02793	idnO	5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
	CKO_02792		2-ketogluconate transporter
	CKO_02791	idnR	Positive regulator of L-idonate catabolism

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD