Regulon of IdnR in Serratia proteamaculans 568

Properties
Regulator type:	Transcription factor
TF locus tag:	Spro_3289
Regulator family:	LacI
Regulation mode:	activator (repressor)
Biological process:	Idonate utilization
Effector:	L-idonate; 5-dehydro-D-gluconate
Regulog:	IdnR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LacI
By effector - L-idonate
By effector - 5-dehydro-D-gluconate
By pathway - Idonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.1 Sequence: TCACGTTAAAGGTAACAGCT Locus tag: Spro_3288 Name: idnO Funciton: 5-keto-D-gluconate 5-reductase (EC 1.1.1.69) Locus tag: Spro_3287 Name: idnD Funciton: L-idonate 5-dehydrogenase (EC 1.1.1.264)
	Spro_3288	idnO	5-keto-D-gluconate 5-reductase (EC 1.1.1.69)
	Spro_3287	idnD	L-idonate 5-dehydrogenase (EC 1.1.1.264)
Position: -169 Score: 5.1 Sequence: AGCTGTTACCTTTAACGTGA Locus tag: Spro_3289 Name: idnR Funciton: Positive regulator of L-idonate catabolism
	Spro_3289	idnR	Positive regulator of L-idonate catabolism

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD