Regulog LJ1265 - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Pentose utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Lactobacillaceae
- By TF family - LacI
- By pathway - Pentose utilization
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | 4 | 2 |
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | ||
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | 6 | 2 |
| Lactobacillus plantarum WCFS1 | ||
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | ||
| Lactobacillus sakei subsp. sakei 23K | ||
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| LJ1266 |
*
Lactobacillus acidophilus NCFM Site: position = -46 score = 6.4036 sequence = TTTTGTAAGCAATTACAAGT Gene: LBA1489: Transketolase, N-terminal section (EC 2.2.1.1) |
|
|
|
|
|
*
Lactobacillus johnsonii NCC 533 Site: position = -45 score = 6.58196 sequence = TTTTGTAAGCATTTACAAGA Gene: LJ1266: Transketolase, N-terminal section (EC 2.2.1.1) |
|
|
|
|
|
|
|
|
Transketolase, N-terminal section (EC 2.2.1.1) |
| LJ1267 |
Gene: LBA1490: Transketolase, C-terminal section (EC 2.2.1.1) |
|
|
|
|
|
Gene: LJ1267: Transketolase, C-terminal section (EC 2.2.1.1) |
|
|
|
|
|
|
|
|
Transketolase, C-terminal section (EC 2.2.1.1) |
| LJ1268 |
Gene: LBA1492: Predicted pentose kinase |
|
|
|
|
|
Gene: LJ1268: Predicted pentose kinase |
|
|
|
|
|
|
|
|
Predicted pentose kinase |
| CRON 2. | ||||||||||||||||
| LJ1265 |
*
Lactobacillus acidophilus NCFM Site: position = -103 score = 6.4036 sequence = ACTTGTAATTGCTTACAAAA Gene: LBA1488: Predicted pentose utilization transcriptional regulator, LacI family |
|
|
|
|
|
*
Lactobacillus johnsonii NCC 533 Site: position = -108 score = 6.58196 sequence = TCTTGTAAATGCTTACAAAA Gene: LJ1265: Predicted pentose utilization transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
Predicted pentose utilization transcriptional regulator, LacI family |
| LJ1264 |
Gene: LBA1486: Predicted pentose isomerase, TM0951 |
|
|
|
|
|
Gene: LJ1264: Predicted pentose isomerase, TM0951 |
|
|
|
|
|
|
|
|
Predicted pentose isomerase, TM0951 |
| LJ1263 |
Gene: LBA1480: Conserved hypothetical protein |
|
|
|
|
|
Gene: LJ1263: Conserved hypothetical protein |
|
|
|
|
|
|
|
|
Conserved hypothetical protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |