Regulon of LJ1265 in Lactobacillus acidophilus NCFM

Properties
Regulator type:	Transcription factor
TF locus tag:	LBA1488
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Pentose utilization
Effector:
Regulog:	LJ1265 - Lactobacillaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By pathway - Pentose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.4 Sequence: TTTTGTAAGCAATTACAAGT Locus tag: LBA1489 Name: LJ1266 Funciton: Transketolase, N-terminal section (EC 2.2.1.1) Locus tag: LBA1490 Name: LJ1267 Funciton: Transketolase, C-terminal section (EC 2.2.1.1) Locus tag: LBA1492 Name: LJ1268 Funciton: Predicted pentose kinase
	LBA1489	LJ1266	Transketolase, N-terminal section (EC 2.2.1.1)
	LBA1490	LJ1267	Transketolase, C-terminal section (EC 2.2.1.1)
	LBA1492	LJ1268	Predicted pentose kinase
Position: -103 Score: 6.4 Sequence: ACTTGTAATTGCTTACAAAA Locus tag: LBA1488 Name: LJ1265 Funciton: Predicted pentose utilization transcriptional regulator, LacI family
	LBA1488	LJ1265	Predicted pentose utilization transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD