Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing LJ1264 gene

Properties
Regulog: LJ1265 - Lactobacillaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Pentose utilization
Effector:
Phylum: Firmicutes
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Lactobacillus johnsonii NCC 533
Position: -108
Score: 6.58196
Sequence: TCTTGTAAATGCTTACAAAA
Locus tag: LJ1265
Name: LJ1265
Funciton: Predicted pentose utilization transcriptional regulator, LacI family
Locus tag: LJ1264
Name: LJ1264
Funciton: Predicted pentose isomerase, TM0951
Locus tag: LJ1263
Name: LJ1263
Funciton: Conserved hypothetical protein
LJ1265-LJ1264-LJ1263 -108 6.6 TCTTGTAAATGCTTACAAAA LJ1265
© 2009-2020 RegPrecise