Regulon of LJ1265 in Lactobacillus johnsonii NCC 533

Properties
Regulator type:	Transcription factor
TF locus tag:	LJ1265
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Pentose utilization
Effector:
Regulog:	LJ1265 - Lactobacillaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Lactobacillaceae
By TF family - LacI
By pathway - Pentose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -45 Score: 6.6 Sequence: TTTTGTAAGCATTTACAAGA Locus tag: LJ1266 Name: LJ1266 Funciton: Transketolase, N-terminal section (EC 2.2.1.1) Locus tag: LJ1267 Name: LJ1267 Funciton: Transketolase, C-terminal section (EC 2.2.1.1) Locus tag: LJ1268 Name: LJ1268 Funciton: Predicted pentose kinase
	LJ1266	LJ1266	Transketolase, N-terminal section (EC 2.2.1.1)
	LJ1267	LJ1267	Transketolase, C-terminal section (EC 2.2.1.1)
	LJ1268	LJ1268	Predicted pentose kinase
Position: -108 Score: 6.6 Sequence: TCTTGTAAATGCTTACAAAA Locus tag: LJ1265 Name: LJ1265 Funciton: Predicted pentose utilization transcriptional regulator, LacI family Locus tag: LJ1264 Name: LJ1264 Funciton: Predicted pentose isomerase, TM0951 Locus tag: LJ1263 Name: LJ1263 Funciton: Conserved hypothetical protein
	LJ1265	LJ1265	Predicted pentose utilization transcriptional regulator, LacI family
	LJ1264	LJ1264	Predicted pentose isomerase, TM0951
	LJ1263	LJ1263	Conserved hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD