Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog MalR2 - Streptococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode:
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124 6 1
Streptococcus equi subsp. zooepidemicus MGCS10565 4 1
Streptococcus gallolyticus UCN34 1 1
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS 6 1
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
malX
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Site:
position = -151
score = 7.00512
sequence = CAACTTAAACGTTTAAATTA

Gene: SDEG_1305: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus equi subsp. zooepidemicus MGCS10565

Site:
position = -163
score = 7.56855
sequence = TAACTTAAACGTTTAAGTTA

Gene: Sez_1266: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0754: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0104: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus mitis B6

Gene: smi_0133: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2108: Maltose/maltodextrin ABC transporter, substrate-binding protein
*
Streptococcus pyogenes M1 GAS

Site:
position = -141
score = 7.29974
sequence = TAACTTAAACGTTTAAGTTT

Gene: SPy1306: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2133: Maltose/maltodextrin ABC transporter, substrate-binding protein
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltose/maltodextrin ABC transporter, substrate-binding protein
amyB
 
Lactococcus lactis subsp. cremoris SK11

Gene: LACR_1852: Neopullulanase (EC 3.2.1.135)
 
Lactococcus lactis subsp. lactis Il1403

Gene: L128694: Neopullulanase (EC 3.2.1.135)
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1304: Neopullulanase (EC 3.2.1.135)
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1265: Neopullulanase (EC 3.2.1.135)
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0753: Neopullulanase (EC 3.2.1.135)
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_1351: Neopullulanase (EC 3.2.1.135)
 
Streptococcus mitis B6

Gene: smi_1104: Neopullulanase (EC 3.2.1.135)
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1304: Neopullulanase (EC 3.2.1.135)
 
Streptococcus sanguinis SK36

Gene: SSA_1457: Neopullulanase (EC 3.2.1.135)
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Neopullulanase (EC 3.2.1.135)
amyA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1264: Cyclodextrin glucanotransferase( EC:2.4.1.19 )
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0757: Cyclodextrin glucanotransferase( EC:2.4.1.19 )
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS

Gene: SPy1302: Cyclodextrin glucanotransferase( EC:2.4.1.19 )
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Cyclodextrin glucanotransferase( EC:2.4.1.19 )
malC
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 2
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1303: Maltose/maltodextrin ABC transporter, permease protein 1

Gene: SDEG_1302: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1263: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0755: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0103: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus mitis B6

Gene: smi_0132: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2109: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus pyogenes M1 GAS

Gene: SPy1301: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2134: Maltose/maltodextrin ABC transporter, permease protein 1
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltose/maltodextrin ABC transporter, permease protein 1
malD
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1301: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus equi subsp. zooepidemicus MGCS10565
 
Streptococcus gallolyticus UCN34

Gene: GALLO_0756: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0102: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus mitis B6

Gene: smi_0131: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2110: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus pyogenes M1 GAS

Gene: SPy1299: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2135: Maltose/maltodextrin ABC transporter, permease protein 2
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltose/maltodextrin ABC transporter, permease protein 2
malA
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124

Gene: SDEG_1300: Maltodextrose utilization protein MalA
 
Streptococcus equi subsp. zooepidemicus MGCS10565

Gene: Sez_1260: Maltodextrose utilization protein MalA
 
Streptococcus gallolyticus UCN34
 
Streptococcus gordonii str. Challis substr. CH1

Gene: SGO_0101: Maltodextrose utilization protein MalA
 
Streptococcus mitis B6

Gene: smi_0130: Maltodextrose utilization protein MalA
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4

Gene: SP_2111: Maltodextrose utilization protein MalA
 
Streptococcus pyogenes M1 GAS

Gene: SPy1298: Maltodextrose utilization protein MalA
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33

Gene: SSU05_2136: Maltodextrose utilization protein MalA
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Maltodextrose utilization protein MalA
 
CRON 2.
GALLO_0751
 
Lactococcus lactis subsp. cremoris SK11
 
Lactococcus lactis subsp. lactis Il1403
 
Streptococcus agalactiae 2603V/R
 
Streptococcus dysgalactiae subsp. equisimilis GGS_124
 
Streptococcus equi subsp. zooepidemicus MGCS10565
*
Streptococcus gallolyticus UCN34

Site:
position = -49
score = 7.56855
sequence = TAACTTAAACGTTTAAGTTA

Gene: GALLO_0751: Putative secreted protein
 
Streptococcus gordonii str. Challis substr. CH1
 
Streptococcus mitis B6
 
Streptococcus mutans UA159
 
Streptococcus pneumoniae TIGR4
 
Streptococcus pyogenes M1 GAS
 
Streptococcus sanguinis SK36
 
Streptococcus suis 05ZYH33
 
Streptococcus thermophilus CNRZ1066
 
Streptococcus uberis 0140J
Putative secreted protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD