Regulon of MalR2 in Streptococcus pyogenes M1 GAS

Properties
Regulator type:	Transcription factor
TF locus tag:	SPy1297
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -141 Score: 7.3 Sequence: TAACTTAAACGTTTAAGTTT Locus tag: SPy1306 Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: SPy1304 Name: amyB Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: SPy1302 Name: amyA Funciton: Cyclodextrin glucanotransferase( EC:2.4.1.19 ) Locus tag: SPy1301 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: SPy1299 Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: SPy1298 Name: malA Funciton: Maltodextrose utilization protein MalA
	SPy1306	malX	Maltose/maltodextrin ABC transporter, substrate-binding protein
	SPy1304	amyB	Neopullulanase (EC 3.2.1.135)
	SPy1302	amyA	Cyclodextrin glucanotransferase( EC:2.4.1.19 )
	SPy1301	malC	Maltose/maltodextrin ABC transporter, permease protein 1
	SPy1299	malD	Maltose/maltodextrin ABC transporter, permease protein 2
	SPy1298	malA	Maltodextrose utilization protein MalA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD