Regulon of MalR2 in Streptococcus dysgalactiae subsp. equisimilis GGS_124

Properties
Regulator type:	Transcription factor
TF locus tag:	SDEG_1299
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Streptococcaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -151 Score: 7 Sequence: CAACTTAAACGTTTAAATTA Locus tag: SDEG_1305 Name: malX Funciton: Maltose/maltodextrin ABC transporter, substrate-binding protein Locus tag: SDEG_1304 Name: amyB Funciton: Neopullulanase (EC 3.2.1.135) Locus tag: SDEG_1303 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: SDEG_1302 Name: malC Funciton: Maltose/maltodextrin ABC transporter, permease protein 1 Locus tag: SDEG_1301 Name: malD Funciton: Maltose/maltodextrin ABC transporter, permease protein 2 Locus tag: SDEG_1300 Name: malA Funciton: Maltodextrose utilization protein MalA
	SDEG_1305	malX	Maltose/maltodextrin ABC transporter, substrate-binding protein
	SDEG_1304	amyB	Neopullulanase (EC 3.2.1.135)
	SDEG_1303	malC	Maltose/maltodextrin ABC transporter, permease protein 1
	SDEG_1302	malC	Maltose/maltodextrin ABC transporter, permease protein 1
	SDEG_1301	malD	Maltose/maltodextrin ABC transporter, permease protein 2
	SDEG_1300	malA	Maltodextrose utilization protein MalA

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD