Regulon of MalR2 in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_0752
Regulator family:	LacI
Regulation mode:
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Regulog:	MalR2 - Streptococcaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - LacI
By effector - Maltose
By pathway - Maltose utilization
By pathway - Maltodextrin utilization

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 7.6 Sequence: TAACTTAAACGTTTAAGTTA Locus tag: GALLO_0751 Name: GALLO_0751 Funciton: Putative secreted protein
	GALLO_0751	GALLO_0751	Putative secreted protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD