Regulon of MalR2 in Streptococcus gallolyticus UCN34
| Regulator type: | Transcription factor |
| TF locus tag: | GALLO_0752 |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Regulog: | MalR2 - Streptococcaceae |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - LacI
- By effector - Maltose
- By pathway - Maltose utilization
- By pathway - Maltodextrin utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -49
Score: 7.6 Sequence: TAACTTAAACGTTTAAGTTA
Locus tag: GALLO_0751
Name: GALLO_0751 Funciton: Putative secreted protein |
|||
|
GALLO_0751
|
Putative secreted protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |