Regulog XapR - Enterobacteriales

Properties
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Xanthosine utilization
Effector:	Deoxyinosine; Xanthosine
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LysR
By effector - Deoxyinosine
By effector - Xanthosine
By pathway - Xanthosine utilization

Statistics of regulated genes
Genome	Genes	Operons
Citrobacter koseri ATCC BAA-895	3	1
Edwardsiella tarda EIB202	3	1
Enterobacter sp. 638	3	1
Erwinia amylovora ATCC 49946
Erwinia carotovora subsp. atroseptica SCRI1043
Escherichia coli str. K-12 substr. MG1655	2	1
Klebsiella pneumoniae subsp. pneumoniae MGH 78578
Photorhabdus luminescens subsp. laumondii TTO1
Proteus mirabilis HI4320
Salmonella typhimurium LT2
Serratia proteamaculans 568
Yersinia pestis KIM

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
xapA	* Citrobacter koseri ATCC BAA-895 Site: position = -120 score = 6.23346 sequence = TCAATATACATTTTATATCGA Gene: CKO_00389: Xanthosine phosphorylase (EC 2.4.2.1)	* Edwardsiella tarda EIB202 Site: position = -115 score = 4.36517 sequence = TCCCTAGCAAATCAATACTGA Gene: ETAE_2779: Xanthosine phosphorylase (EC 2.4.2.1)	* Enterobacter sp. 638 Site: position = -121 score = 5.16572 sequence = TTGATACTGAAAGAGTATTGA Gene: Ent638_2934: Xanthosine phosphorylase (EC 2.4.2.1)	Erwinia amylovora ATCC 49946	Erwinia carotovora subsp. atroseptica SCRI1043	* Escherichia coli str. K-12 substr. MG1655 Site: position = -107 score = 5.91526 sequence = TCGATATCGAATCGCTATTGA Site: position = -132 score = 4.22582 sequence = TTAATAGAGAAAAGATATAAA Gene: b2407: Xanthosine phosphorylase (EC 2.4.2.1)	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Photorhabdus luminescens subsp. laumondii TTO1	Proteus mirabilis HI4320	Salmonella typhimurium LT2	Serratia proteamaculans 568 Gene: Spro_4255: Xanthosine phosphorylase (EC 2.4.2.1)	Yersinia pestis KIM	Xanthosine phosphorylase (EC 2.4.2.1)
xapX	Citrobacter koseri ATCC BAA-895	Edwardsiella tarda EIB202 Gene: ETAE_2780: Predicted xanthosine transporter	Enterobacter sp. 638	Erwinia amylovora ATCC 49946	Erwinia carotovora subsp. atroseptica SCRI1043	Escherichia coli str. K-12 substr. MG1655	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Photorhabdus luminescens subsp. laumondii TTO1	Proteus mirabilis HI4320	Salmonella typhimurium LT2	Serratia proteamaculans 568	Yersinia pestis KIM	Predicted xanthosine transporter
xapR	Citrobacter koseri ATCC BAA-895 Gene: CKO_00391: Xanthosine operon regulatory protein XapR, LysR family	Edwardsiella tarda EIB202 Gene: ETAE_2781: Xanthosine operon regulatory protein XapR, LysR family	Enterobacter sp. 638 Gene: Ent638_2932: Xanthosine operon regulatory protein XapR, LysR family	Erwinia amylovora ATCC 49946	Erwinia carotovora subsp. atroseptica SCRI1043	Escherichia coli str. K-12 substr. MG1655 Gene: b2405: Xanthosine operon regulatory protein XapR, LysR family	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Photorhabdus luminescens subsp. laumondii TTO1	Proteus mirabilis HI4320	Salmonella typhimurium LT2 Gene: STM2420: Xanthosine operon regulatory protein XapR, LysR family	Serratia proteamaculans 568 Gene: Spro_4256: Xanthosine operon regulatory protein XapR, LysR family	Yersinia pestis KIM	Xanthosine operon regulatory protein XapR, LysR family
xapB	Citrobacter koseri ATCC BAA-895 Gene: CKO_00390: Xanthosine permease	Edwardsiella tarda EIB202	Enterobacter sp. 638 Gene: Ent638_2933: Xanthosine permease	Erwinia amylovora ATCC 49946	Erwinia carotovora subsp. atroseptica SCRI1043	Escherichia coli str. K-12 substr. MG1655 Gene: b2406: Xanthosine permease	Klebsiella pneumoniae subsp. pneumoniae MGH 78578	Photorhabdus luminescens subsp. laumondii TTO1	Proteus mirabilis HI4320	Salmonella typhimurium LT2 Gene: STM2421: Xanthosine permease	Serratia proteamaculans 568 Gene: Spro_4254: Xanthosine permease	Yersinia pestis KIM	Xanthosine permease

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog XapR - Enterobacteriales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --