Regulon of XapR in Edwardsiella tarda EIB202

Properties
Regulator type:	Transcription factor
TF locus tag:	ETAE_2781
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Xanthosine utilization
Effector:	Deoxyinosine; Xanthosine
Regulog:	XapR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LysR
By effector - Deoxyinosine
By effector - Xanthosine
By pathway - Xanthosine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 4.4 Sequence: TCCCTAGCAAATCAATACTGA Locus tag: ETAE_2779 Name: xapA Funciton: Xanthosine phosphorylase (EC 2.4.2.1) Locus tag: ETAE_2780 Name: xapX Funciton: Predicted xanthosine transporter Locus tag: ETAE_2781 Name: xapR Funciton: Xanthosine operon regulatory protein XapR, LysR family
	ETAE_2779	xapA	Xanthosine phosphorylase (EC 2.4.2.1)
	ETAE_2780	xapX	Predicted xanthosine transporter
	ETAE_2781	xapR	Xanthosine operon regulatory protein XapR, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD