Regulon of XapR in Enterobacter sp. 638

Properties
Regulator type:	Transcription factor
TF locus tag:	Ent638_2932
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Xanthosine utilization
Effector:	Deoxyinosine; Xanthosine
Regulog:	XapR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LysR
By effector - Deoxyinosine
By effector - Xanthosine
By pathway - Xanthosine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.2 Sequence: TTGATACTGAAAGAGTATTGA Locus tag: Ent638_2934 Name: xapA Funciton: Xanthosine phosphorylase (EC 2.4.2.1) Locus tag: Ent638_2933 Name: xapB Funciton: Xanthosine permease Locus tag: Ent638_2932 Name: xapR Funciton: Xanthosine operon regulatory protein XapR, LysR family
	Ent638_2934	xapA	Xanthosine phosphorylase (EC 2.4.2.1)
	Ent638_2933	xapB	Xanthosine permease
	Ent638_2932	xapR	Xanthosine operon regulatory protein XapR, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD