Regulon of XapR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_00391
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Xanthosine utilization
Effector:	Deoxyinosine; Xanthosine
Regulog:	XapR - Enterobacteriales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LysR
By effector - Deoxyinosine
By effector - Xanthosine
By pathway - Xanthosine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -120 Score: 6.2 Sequence: TCAATATACATTTTATATCGA Locus tag: CKO_00389 Name: xapA Funciton: Xanthosine phosphorylase (EC 2.4.2.1) Locus tag: CKO_00390 Name: xapB Funciton: Xanthosine permease Locus tag: CKO_00391 Name: xapR Funciton: Xanthosine operon regulatory protein XapR, LysR family
	CKO_00389	xapA	Xanthosine phosphorylase (EC 2.4.2.1)
	CKO_00390	xapB	Xanthosine permease
	CKO_00391	xapR	Xanthosine operon regulatory protein XapR, LysR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD