Regulon of XapR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type:	Transcription factor
TF locus tag:	b2405
Regulator family:	LysR
Regulation mode:	activator
Biological process:	Xanthosine utilization
Effector:	Deoxyinosine; Xanthosine
Regulog:	XapR - Enterobacteriales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - LysR
By effector - Deoxyinosine
By effector - Xanthosine
By pathway - Xanthosine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -132 Score: 4.2 Sequence: TTAATAGAGAAAAGATATAAA Position: -107 Score: 5.9 Sequence: TCGATATCGAATCGCTATTGA Locus tag: b2407 Name: xapA Funciton: Xanthosine phosphorylase (EC 2.4.2.1) Locus tag: b2406 Name: xapB Funciton: Xanthosine permease
	b2407	xapA	Xanthosine phosphorylase (EC 2.4.2.1)
	b2406	xapB	Xanthosine permease

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD