Regulog NiaR - Lactobacillaceae
| Regulator type: | Transcription factor |
| Regulator family: | NiaR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Niacin |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NiaR
- By taxonomy - Lactobacillaceae
- By TF family - NiaR
- By effector - Niacin
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Lactobacillus acidophilus NCFM | ||
| Lactobacillus brevis ATCC 367 | ||
| Lactobacillus casei ATCC 334 | 1 | 1 |
| Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 | ||
| Lactobacillus fermentum IFO 3956 | ||
| Lactobacillus helveticus DPC 4571 | ||
| Lactobacillus johnsonii NCC 533 | ||
| Lactobacillus plantarum WCFS1 | 2 | 2 |
| Lactobacillus reuteri JCM 1112 | ||
| Lactobacillus rhamnosus GG | 1 | 1 |
| Lactobacillus sakei subsp. sakei 23K | 1 | 1 |
| Lactobacillus salivarius subsp. salivarius UCC118 | ||
| Leuconostoc mesenteroides subsp. mesenteroides ATCC 8293 | ||
| Oenococcus oeni PSU-1 | ||
| Pediococcus pentosaceus ATCC 25745 | 2 | 2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| niaR |
|
|
Gene: LSEI_0807: NAD biosynthesis transcription regulator, HTH_11 family |
|
|
|
|
*
Lactobacillus plantarum WCFS1 Site: position = -121 score = 5.79768 sequence = TTTAGATGTCTTGACACCTATG Gene: lp_2770: NAD biosynthesis transcription regulator, HTH_11 family |
|
Gene: LGG_00791: NAD biosynthesis transcription regulator, HTH_11 family |
Gene: LSA1530: NAD biosynthesis transcription regulator, HTH_11 family |
|
|
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -64 score = 5.58601 sequence = AATTAATGTCTTGACACTTGTA Gene: PEPE_0214: NAD biosynthesis transcription regulator, HTH_11 family |
NAD biosynthesis transcription regulator, HTH_11 family |
| CRON 2. | ||||||||||||||||
| niaP |
|
|
*
Lactobacillus casei ATCC 334 Site: position = -45 score = 5.00161 sequence = CTAGGGTGTCAAGACACCCTAA Gene: LSEI_2277: Niacin transporter NiaP |
|
|
|
|
Gene: lp_2514: Niacin transporter NiaP |
|
*
Lactobacillus rhamnosus GG Site: position = -51 score = 5.56054 sequence = TTAGGGTGTCAAGACACCTAAT Gene: LGG_02281: Niacin transporter NiaP |
*
Lactobacillus sakei subsp. sakei 23K Site: position = -76 score = 5.85793 sequence = TTAAGGTGTGTTGACACCTGTA Gene: LSA1529: Niacin transporter NiaP |
|
Gene: LEUM_0911: Niacin transporter NiaP |
|
*
Pediococcus pentosaceus ATCC 25745 Site: position = -112 score = 5.58601 sequence = TACAAGTGTCAAGACATTAATT Gene: PEPE_0213: Niacin transporter NiaP |
Niacin transporter NiaP |
| CRON 3. | ||||||||||||||||
| pncB |
|
|
Gene: LSEI_2766: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: LBUL_0276: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: LAF_1391: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: lhv_0930: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
|
*
Lactobacillus plantarum WCFS1 Site: position = -46 score = 5.79768 sequence = CATAGGTGTCAAGACATCTAAA Gene: lp_2771: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: LAR_0148: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Gene: LGG_02765: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
|
|
|
Gene: OEOE_0890: Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
|
Nicotinate phosphoribosyltransferase (EC 2.4.2.11) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |