Regulon of NiaR in Lactobacillus plantarum WCFS1

Properties
Regulator type:	Transcription factor
TF locus tag:	lp_2770
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By trascription factor - NiaR
By taxonomy - Lactobacillaceae
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -121 Score: 5.8 Sequence: TTTAGATGTCTTGACACCTATG Locus tag: lp_2770 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	lp_2770	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -46 Score: 5.8 Sequence: CATAGGTGTCAAGACATCTAAA Locus tag: lp_2771 Name: pncB Funciton: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
	lp_2771	pncB	Nicotinate phosphoribosyltransferase (EC 2.4.2.11)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD