Regulon of NiaR in Pediococcus pentosaceus ATCC 25745

Properties
Regulator type:	Transcription factor
TF locus tag:	PEPE_0214
Regulator family:	NiaR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Niacin
Regulog:	NiaR - Lactobacillaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By trascription factor - NiaR
By taxonomy - Lactobacillaceae
By TF family - NiaR
By effector - Niacin
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -64 Score: 5.6 Sequence: AATTAATGTCTTGACACTTGTA Locus tag: PEPE_0214 Name: niaR Funciton: NAD biosynthesis transcription regulator, HTH_11 family
	PEPE_0214	niaR	NAD biosynthesis transcription regulator, HTH_11 family
Position: -112 Score: 5.6 Sequence: TACAAGTGTCAAGACATTAATT Locus tag: PEPE_0213 Name: niaP Funciton: Niacin transporter NiaP
	PEPE_0213	niaP	Niacin transporter NiaP

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD