Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus aggregans DSM 9485	8	5
Chloroflexus sp. Y-400-fl	3	1
Roseiflexus castenholzii DSM 13941	4	2
Herpetosiphon aurantiacus ATCC 23779	11	8
Roseiflexus sp. RS-1	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
Haur_1311	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -47 score = 5.94691 sequence = TATTGATATAATATATCAGTA Gene: Haur_1311: Acetyltransferase	Roseiflexus sp. RS-1	Acetyltransferase
CRON 2.
Haur_3793	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -34 score = 6.13962 sequence = TATTGATATCAAGTATCAATA Gene: Haur_3793: Thioredoxin reductase (EC 1.8.1.9)	Roseiflexus sp. RS-1	Thioredoxin reductase (EC 1.8.1.9)
CRON 3.
Haur_2300	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -80 score = 6.49117 sequence = TAATGATACTTTGTATCAATA Gene: Haur_2300: cold-shock DNA-binding domain protein	Roseiflexus sp. RS-1	cold-shock DNA-binding domain protein
CRON 4.
Rcas_3893	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3893: hypothetical protein	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -20 score = 6.34355 sequence = TAATGATATATAGTATCAATA Site: position = -82 score = 6.49777 sequence = TAATGATACATTATATCAATA Gene: Haur_4472: hypothetical protein	Roseiflexus sp. RS-1 Gene: RoseRS_0845: hypothetical protein	hypothetical protein
CRON 5.
yciC3	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -54 score = 6.59304 sequence = TATTGATATATTGTATCAATA Gene: Haur_2062: Putative metal chaperone involved in Zn homeostasis, COG0523 family	Roseiflexus sp. RS-1	Putative metal chaperone involved in Zn homeostasis, COG0523 family
CRON 6.
znuA	* Chloroflexus aggregans DSM 9485 Site: position = -35 score = 5.92053 sequence = AATTGAAACATAGTTTCATTA Gene: Cagg_2043: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Chloroflexus sp. Y-400-fl Site: position = -35 score = 6.07475 sequence = TTTTGAAACAATGTTTCATTA Gene: Chy400_2148: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Roseiflexus castenholzii DSM 13941 Site: position = -122 score = 5.34844 sequence = TATCCATACCACATATCAATA Gene: Rcas_1591: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -95 score = 6.24827 sequence = TAATGATACAAAATATCATTA Gene: Haur_2064: Zinc ABC transporter, periplasmic-binding protein ZnuA	* Roseiflexus sp. RS-1 Site: position = -124 score = 5.54577 sequence = TATAAAAACGAAGTATCAATA Gene: RoseRS_1258: Zinc ABC transporter, periplasmic-binding protein ZnuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC	Chloroflexus aggregans DSM 9485 Gene: Cagg_2044: Zinc ABC transporter, ATP-binding protein ZnuC	Chloroflexus sp. Y-400-fl Gene: Chy400_2149: Zinc ABC transporter, ATP-binding protein ZnuC	Roseiflexus castenholzii DSM 13941 Gene: Rcas_1590: Zinc ABC transporter, ATP-binding protein ZnuC	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_2065: Zinc ABC transporter, ATP-binding protein ZnuC	Roseiflexus sp. RS-1 Gene: RoseRS_1257: Zinc ABC transporter, ATP-binding protein ZnuC	Zinc ABC transporter, ATP-binding protein ZnuC
znuB	Chloroflexus aggregans DSM 9485 Gene: Cagg_2045: Zinc ABC transporter, permease protein ZnuB	Chloroflexus sp. Y-400-fl Gene: Chy400_2150: Zinc ABC transporter, permease protein ZnuB	Roseiflexus castenholzii DSM 13941 Gene: Rcas_1589: Zinc ABC transporter, permease protein ZnuB	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_2066: Zinc ABC transporter, permease protein ZnuB	Roseiflexus sp. RS-1 Gene: RoseRS_1256: Zinc ABC transporter, permease protein ZnuB	Zinc ABC transporter, permease protein ZnuB
CRON 7.
COG0701	* Chloroflexus aggregans DSM 9485 Site: position = -74 score = 5.7849 sequence = TATTGACACACTGTATCAATA Gene: Cagg_2028: predicted permease	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3894: predicted permease	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus sp. RS-1 Gene: RoseRS_0592: predicted permease	predicted permease
CRON 8.
yciC	* Chloroflexus aggregans DSM 9485 Site: position = -79 score = 5.81023 sequence = TAATGATATAACGTATCATTT Site: position = -20 score = 4.48867 sequence = AATCGAGATAAGGTATCAATG Gene: Cagg_0608: Putative metal chaperone involved in Zn homeostasis, COG0523 family	Chloroflexus sp. Y-400-fl	* Roseiflexus castenholzii DSM 13941 Site: position = -58 score = 4.25038 sequence = CATTGATATACACTATCATCA Gene: Rcas_2945: Putative metal chaperone involved in Zn homeostasis, COG0523 family	* Herpetosiphon aurantiacus ATCC 23779 Site: position = -42 score = 6.34355 sequence = TAATGATATATAGTATCAATA Gene: Haur_0639: Putative metal chaperone involved in Zn homeostasis, COG0523 family	Roseiflexus sp. RS-1 Gene: RoseRS_3105: Putative metal chaperone involved in Zn homeostasis, COG0523 family	Putative metal chaperone involved in Zn homeostasis, COG0523 family
CRON 9.
fmdB	* Chloroflexus aggregans DSM 9485 Site: position = -52 score = 5.47155 sequence = AAATGATATATTATCTCAATA Gene: Cagg_0322: putative regulatory protein, FmdB family	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941 Gene: Rcas_2948: putative regulatory protein, FmdB family	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_2075: putative regulatory protein, FmdB family	Roseiflexus sp. RS-1 Gene: RoseRS_3107: putative regulatory protein, FmdB family	putative regulatory protein, FmdB family
yciC2	Chloroflexus aggregans DSM 9485 Gene: Cagg_0321: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Chloroflexus sp. Y-400-fl	Roseiflexus castenholzii DSM 13941 Gene: Rcas_2949: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	*2 Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_4200: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family Site: position = -286 score = 6.49777 sequence = TAATGATATATTGTATCAATA Gene: Haur_2074: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Roseiflexus sp. RS-1 Gene: RoseRS_3108: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
zur	*2 Chloroflexus aggregans DSM 9485 Site: position = -2 score = 5.82342 sequence = TAATGATCCATAGTATCATTA Gene: Cagg_2024: Zinc homeostasis transcriptional regulator Zur, Fur family Gene: Cagg_1460: Zinc homeostasis transcriptional regulator Zur, Fur family	Chloroflexus sp. Y-400-fl Gene: Chy400_1857: Zinc homeostasis transcriptional regulator Zur, Fur family	2 Roseiflexus castenholzii DSM 13941 Gene: Rcas_3901: Zinc homeostasis transcriptional regulator Zur, Fur family Gene: Rcas_1649: Zinc homeostasis transcriptional regulator Zur, Fur family	Herpetosiphon aurantiacus ATCC 23779 Gene: Haur_2073: Zinc homeostasis transcriptional regulator Zur, Fur family	Roseiflexus sp. RS-1 Gene: RoseRS_1293: Zinc homeostasis transcriptional regulator Zur, Fur family	Zinc homeostasis transcriptional regulator Zur, Fur family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD