Regulon of Zur in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_1293
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Chloroflexia
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5.5 Sequence: TATAAAAACGAAGTATCAATA Locus tag: RoseRS_1258 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: RoseRS_1257 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: RoseRS_1256 Name: znuB Funciton: Zinc ABC transporter, permease protein ZnuB
	RoseRS_1258	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	RoseRS_1257	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	RoseRS_1256	znuB	Zinc ABC transporter, permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD