Regulon of Zur in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_2024, Cagg_1460
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Chloroflexia
Statistics of regulated genes:
- Genes	8
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.5 Sequence: AAATGATATATTATCTCAATA Locus tag: Cagg_0322 Name: fmdB Funciton: putative regulatory protein, FmdB family Locus tag: Cagg_0321 Name: yciC2 Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	Cagg_0322	fmdB	putative regulatory protein, FmdB family
	Cagg_0321	yciC2	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -2 Score: 5.8 Sequence: TAATGATCCATAGTATCATTA Locus tag: Cagg_2024 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
	Cagg_2024	zur	Zinc homeostasis transcriptional regulator Zur, Fur family
Position: -74 Score: 5.8 Sequence: TATTGACACACTGTATCAATA Locus tag: Cagg_2028 Name: COG0701 Funciton: predicted permease
	Cagg_2028	COG0701	predicted permease
Position: -79 Score: 5.8 Sequence: TAATGATATAACGTATCATTT Position: -20 Score: 4.5 Sequence: AATCGAGATAAGGTATCAATG Locus tag: Cagg_0608 Name: yciC Funciton: Putative metal chaperone involved in Zn homeostasis, COG0523 family
	Cagg_0608	yciC	Putative metal chaperone involved in Zn homeostasis, COG0523 family
Position: -35 Score: 5.9 Sequence: AATTGAAACATAGTTTCATTA Locus tag: Cagg_2043 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Cagg_2044 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Cagg_2045 Name: znuB Funciton: Zinc ABC transporter, permease protein ZnuB
	Cagg_2043	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Cagg_2044	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Cagg_2045	znuB	Zinc ABC transporter, permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD