Regulon of Zur in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_3901, Rcas_1649
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Chloroflexia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 19 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 4.3 Sequence: CATTGATATACACTATCATCA Locus tag: Rcas_2945 Name: yciC Funciton: Putative metal chaperone involved in Zn homeostasis, COG0523 family
	Rcas_2945	yciC	Putative metal chaperone involved in Zn homeostasis, COG0523 family
Position: -122 Score: 5.3 Sequence: TATCCATACCACATATCAATA Locus tag: Rcas_1591 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: Rcas_1590 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: Rcas_1589 Name: znuB Funciton: Zinc ABC transporter, permease protein ZnuB
	Rcas_1591	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	Rcas_1590	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	Rcas_1589	znuB	Zinc ABC transporter, permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD