Regulog DVU0436 - Desulfovibrionales

Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - TetR
Genome | Genes | Operons |
---|---|---|
Desulfohalobium retbaense DSM 5692 | ||
Desulfomicrobium baculatum DSM 4028 | ||
Desulfovibrio desulfuricans G20 | ||
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | ||
Desulfovibrio magneticus RS-1 | ||
Desulfovibrio piger ATCC 29098 | ||
Desulfovibrio salexigens DSM 2638 | ||
Desulfovibrio vulgaris Hildenborough | 3 | 1 |
Desulfovibrio vulgaris str. Miyazaki F | 3 | 1 |
Lawsonia intracellularis PHE/MN1-00 |
Genes | Function | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||
DVU0436 |
|
|
|
|
|
|
|
*
Desulfovibrio vulgaris Hildenborough Site: position = 10 score = 6.97609 sequence = TGGCTAAACGGTCGTTTAGAAA Gene: DVU0436: Transcriptional regulator, TetR family |
*
Desulfovibrio vulgaris str. Miyazaki F Site: position = -160 score = 6.97609 sequence = TTCTTAAACACTCGTTTAAGTA Gene: DvMF_1517: Transcriptional regulator, TetR family |
|
Transcriptional regulator, TetR family |
DVU0437 |
|
|
|
Gene: Ddes_0900: efflux transporter, RND family, MFP subunit |
|
Gene: DESPIG_02514: efflux transporter, RND family, MFP subunit |
|
Gene: DVU0437: efflux transporter, RND family, MFP subunit |
Gene: DvMF_1516: efflux transporter, RND family, MFP subunit |
|
efflux transporter, RND family, MFP subunit |
DVU0438 |
|
|
|
Gene: Ddes_2138: RND multidrug efflux transporter; Acriflavin resistance protein |
Gene: DMR_34140: RND multidrug efflux transporter; Acriflavin resistance protein |
Gene: DESPIG_02381: RND multidrug efflux transporter; Acriflavin resistance protein |
|
Gene: DVU0438: RND multidrug efflux transporter; Acriflavin resistance protein |
Gene: DvMF_1515: RND multidrug efflux transporter; Acriflavin resistance protein |
|
RND multidrug efflux transporter; Acriflavin resistance protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |