Profile of regulator DVU0436 in Desulfovibrionales
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | DVU0436 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - TetR
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio vulgaris Hildenborough | |||||
| DVU0436 | null | 10 | 7 | TGGCTAAACGGTCGTTTAGAAA | |
| Desulfovibrio vulgaris str. Miyazaki F | |||||
| DvMF_1517 | null | -160 | 7 | TTCTTAAACACTCGTTTAAGTA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |