Regulon of DVU0436 in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU0436
Regulator family:	TetR
Regulation mode:
Biological process:
Effector:
Regulog:	DVU0436 - Desulfovibrionales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - TetR

Regulated operons
	Locus Tag	Name	Function
Position: 10 Score: 7 Sequence: TGGCTAAACGGTCGTTTAGAAA Locus tag: DVU0436 Name: null Funciton: Transcriptional regulator, TetR family Locus tag: DVU0437 Name: null Funciton: efflux transporter, RND family, MFP subunit Locus tag: DVU0438 Name: null Funciton: RND multidrug efflux transporter; Acriflavin resistance protein
	DVU0436		Transcriptional regulator, TetR family
	DVU0437		efflux transporter, RND family, MFP subunit
	DVU0438		RND multidrug efflux transporter; Acriflavin resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD