Regulon of DVU0436 in Desulfovibrio vulgaris str. Miyazaki F
| Regulator type: | Transcription factor |
| TF locus tag: | DvMF_1517 |
| Regulator family: | TetR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | DVU0436 - Desulfovibrionales |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - TetR
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -160
Score: 7 Sequence: TTCTTAAACACTCGTTTAAGTA
Locus tag: DvMF_1517
Name: null Funciton: Transcriptional regulator, TetR family
Locus tag: DvMF_1516
Name: null Funciton: efflux transporter, RND family, MFP subunit
Locus tag: DvMF_1515
Name: null Funciton: RND multidrug efflux transporter; Acriflavin resistance protein |
|||
|
Transcriptional regulator, TetR family
|
|||
|
efflux transporter, RND family, MFP subunit
|
|||
|
RND multidrug efflux transporter; Acriflavin resistance protein
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |