Statistics of regulated genes

Genome	Genes	Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756	11	3
Caulobacter sp. K31	11	4
Phenylobacterium zucineum HLK1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes					Function
CRON 1.
COG3511	Caulobacter crescentus CB15	* Caulobacter segnis ATCC 21756 Site: position = -40 score = 5.99349 sequence = AATCTGGTCTATACCAAACT Gene: Cseg_3204: phospholipase C, phosphocholine-specific	* Caulobacter sp. K31 Site: position = -39 score = 5.88797 sequence = ATTTTGGTCTATACCAGAAT Site: position = -115 score = 3.94805 sequence = CAACTGGATCAGACCACTGA Gene: Caul_2987: phospholipase C, phosphocholine-specific	Phenylobacterium zucineum HLK1	phospholipase C, phosphocholine-specific
COG4341	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3205: Predicted HD phosphohydrolase	Caulobacter sp. K31 Gene: Caul_2988: Predicted HD phosphohydrolase	Phenylobacterium zucineum HLK1	Predicted HD phosphohydrolase
CRON 2.
phnR	Caulobacter crescentus CB15	* Caulobacter segnis ATCC 21756 Site: position = -151 score = 5.75107 sequence = AGTTTGGTATAGACCAGATT Gene: Cseg_3203: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family	* Caulobacter sp. K31 Site: position = -165 score = 6.42722 sequence = ATTCTGGTATAGACCAAAAT Gene: Caul_2986: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family	Phenylobacterium zucineum HLK1	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Cseg_3202	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3202: conserved membrane protein, probable transporter	* Caulobacter sp. K31 Site: position = -40 score = 5.35722 sequence = GATTTGGTCTAGACCAGAAC Gene: Caul_2985: conserved membrane protein, probable transporter	Phenylobacterium zucineum HLK1	conserved membrane protein, probable transporter
CRON 3.
omp	Caulobacter crescentus CB15	* Caulobacter segnis ATCC 21756 Site: position = -208 score = 5.13676 sequence = GATTTGGTATAGTCCAAAAT Site: position = -37 score = 4.6371 sequence = CCACTGGTCCATACCAGAGT Gene: Cseg_3212: TonB-dependent receptor	* Caulobacter sp. K31 Site: position = -35 score = 5.15488 sequence = CAACTGGTTCATACCAGTTG Gene: Caul_2995: TonB-dependent receptor	Phenylobacterium zucineum HLK1	TonB-dependent receptor
Cseg_3211	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3211: hypothetical protein	Caulobacter sp. K31 Gene: Caul_2994: hypothetical protein	Phenylobacterium zucineum HLK1	hypothetical protein
Cseg_3210	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3210: aspartyl/asparaginyl beta-hydroxylase	Caulobacter sp. K31 Gene: Caul_2993: aspartyl/asparaginyl beta-hydroxylase	Phenylobacterium zucineum HLK1	aspartyl/asparaginyl beta-hydroxylase
Cseg_3209	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3209: TPR repeat-containing protein	Caulobacter sp. K31 Gene: Caul_2992: TPR repeat-containing protein	Phenylobacterium zucineum HLK1	TPR repeat-containing protein
Cseg_3208	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3208: aspartyl/asparaginyl beta-hydroxylase	Caulobacter sp. K31 Gene: Caul_2991: aspartyl/asparaginyl beta-hydroxylase	Phenylobacterium zucineum HLK1	aspartyl/asparaginyl beta-hydroxylase
Cseg_3207	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3207: FAD dependent oxidoreductase	Caulobacter sp. K31 Gene: Caul_2990: FAD dependent oxidoreductase	Phenylobacterium zucineum HLK1	FAD dependent oxidoreductase
phnX	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756 Gene: Cseg_3206: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Caulobacter sp. K31 Gene: Caul_2989: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)	Phenylobacterium zucineum HLK1	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD