Orthologous regulated operons containing phnR gene

Properties
Regulog:	PhnR - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Phylum:	Proteobacteria/alpha

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter segnis ATCC 21756
Position: -151 Score: 5.75107 Sequence: AGTTTGGTATAGACCAGATT Locus tag: Cseg_3203 Name: phnR Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family Locus tag: Cseg_3202 Name: Cseg_3202 Funciton: conserved membrane protein, probable transporter
phnR-Cseg_3202	-151	5.8	AGTTTGGTATAGACCAGATT	Cseg_3203
Caulobacter sp. K31
Position: -165 Score: 6.42722 Sequence: ATTCTGGTATAGACCAAAAT Locus tag: Caul_2986 Name: phnR Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
phnR	-165	6.4	ATTCTGGTATAGACCAAAAT	Caul_2986

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --