Regulon of PhnR in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_2986
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Caulobacterales
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Caulobacterales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 3.9 Sequence: CAACTGGATCAGACCACTGA Position: -39 Score: 5.9 Sequence: ATTTTGGTCTATACCAGAAT Locus tag: Caul_2987 Name: COG3511 Funciton: phospholipase C, phosphocholine-specific Locus tag: Caul_2988 Name: COG4341 Funciton: Predicted HD phosphohydrolase
	Caul_2987	COG3511	phospholipase C, phosphocholine-specific
	Caul_2988	COG4341	Predicted HD phosphohydrolase
Position: -40 Score: 5.4 Sequence: GATTTGGTCTAGACCAGAAC Locus tag: Caul_2985 Name: Cseg_3202 Funciton: conserved membrane protein, probable transporter
	Caul_2985	Cseg_3202	conserved membrane protein, probable transporter
Position: -165 Score: 6.4 Sequence: ATTCTGGTATAGACCAAAAT Locus tag: Caul_2986 Name: phnR Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	Caul_2986	phnR	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Position: -35 Score: 5.2 Sequence: CAACTGGTTCATACCAGTTG Locus tag: Caul_2995 Name: omp Funciton: TonB-dependent receptor Locus tag: Caul_2994 Name: Cseg_3211 Funciton: hypothetical protein Locus tag: Caul_2993 Name: Cseg_3210 Funciton: aspartyl/asparaginyl beta-hydroxylase Locus tag: Caul_2992 Name: Cseg_3209 Funciton: TPR repeat-containing protein Locus tag: Caul_2991 Name: Cseg_3208 Funciton: aspartyl/asparaginyl beta-hydroxylase Locus tag: Caul_2990 Name: Cseg_3207 Funciton: FAD dependent oxidoreductase Locus tag: Caul_2989 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	Caul_2995	omp	TonB-dependent receptor
	Caul_2994	Cseg_3211	hypothetical protein
	Caul_2993	Cseg_3210	aspartyl/asparaginyl beta-hydroxylase
	Caul_2992	Cseg_3209	TPR repeat-containing protein
	Caul_2991	Cseg_3208	aspartyl/asparaginyl beta-hydroxylase
	Caul_2990	Cseg_3207	FAD dependent oxidoreductase
	Caul_2989	phnX	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD