Regulon of PhnR in Caulobacter segnis ATCC 21756

Properties
Regulator type:	Transcription factor
TF locus tag:	Cseg_3203
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:
Regulog:	PhnR - Caulobacterales
Statistics of regulated genes:
- Genes	11
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By trascription factor - PhnR
By taxonomy - Caulobacterales
By TF family - GntR/Others
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 6 Sequence: AATCTGGTCTATACCAAACT Locus tag: Cseg_3204 Name: COG3511 Funciton: phospholipase C, phosphocholine-specific Locus tag: Cseg_3205 Name: COG4341 Funciton: Predicted HD phosphohydrolase
	Cseg_3204	COG3511	phospholipase C, phosphocholine-specific
	Cseg_3205	COG4341	Predicted HD phosphohydrolase
Position: -151 Score: 5.8 Sequence: AGTTTGGTATAGACCAGATT Locus tag: Cseg_3203 Name: phnR Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family Locus tag: Cseg_3202 Name: Cseg_3202 Funciton: conserved membrane protein, probable transporter
	Cseg_3203	phnR	2-aminoethylphosphonate uptake and metabolism regulator, GntR family
	Cseg_3202	Cseg_3202	conserved membrane protein, probable transporter
Position: -208 Score: 5.1 Sequence: GATTTGGTATAGTCCAAAAT Position: -37 Score: 4.6 Sequence: CCACTGGTCCATACCAGAGT Locus tag: Cseg_3212 Name: omp Funciton: TonB-dependent receptor Locus tag: Cseg_3211 Name: Cseg_3211 Funciton: hypothetical protein Locus tag: Cseg_3210 Name: Cseg_3210 Funciton: aspartyl/asparaginyl beta-hydroxylase Locus tag: Cseg_3209 Name: Cseg_3209 Funciton: TPR repeat-containing protein Locus tag: Cseg_3208 Name: Cseg_3208 Funciton: aspartyl/asparaginyl beta-hydroxylase Locus tag: Cseg_3207 Name: Cseg_3207 Funciton: FAD dependent oxidoreductase Locus tag: Cseg_3206 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	Cseg_3212	omp	TonB-dependent receptor
	Cseg_3211	Cseg_3211	hypothetical protein
	Cseg_3210	Cseg_3210	aspartyl/asparaginyl beta-hydroxylase
	Cseg_3209	Cseg_3209	TPR repeat-containing protein
	Cseg_3208	Cseg_3208	aspartyl/asparaginyl beta-hydroxylase
	Cseg_3207	Cseg_3207	FAD dependent oxidoreductase
	Cseg_3206	phnX	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD