Statistics of regulated genes

Genome	Genes	Operons
Desulfohalobium retbaense DSM 5692
Desulfomicrobium baculatum DSM 4028
Desulfovibrio desulfuricans G20	9	1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio magneticus RS-1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio vulgaris Hildenborough	9	1
Desulfovibrio vulgaris str. Miyazaki F	8	1
Lawsonia intracellularis PHE/MN1-00

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes											Function
CRON 1.
tmcD	Desulfohalobium retbaense DSM 5692 Gene: Dret_1030: hypothetical protein	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0564: hypothetical protein	* Desulfovibrio desulfuricans G20 Site: position = -149 score = 5.31088 sequence = TACTCCACCACTACAGTATAGTT Site: position = -83 score = 5.82314 sequence = ATGTCTACCCAAAAGATAGAGTT Site: position = -217 score = 6.14688 sequence = TTCTATACCAAACAGGTATAGTA Gene: Dde_3707: hypothetical protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_42520: hypothetical protein	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_3043: hypothetical protein	* Desulfovibrio vulgaris Hildenborough Site: position = -182 score = 5.87483 sequence = TTGTCTACCATGACAGTAGTATT Gene: DVU0266: hypothetical protein	* Desulfovibrio vulgaris str. Miyazaki F Site: position = -170 score = 6.13729 sequence = AAATCTACCACGCAAGTAGACTA Site: position = -195 score = 5.6944 sequence = AACTATACCATTGCAGTATACAA Gene: DvMF_2557: hypothetical protein	Lawsonia intracellularis PHE/MN1-00	hypothetical protein
tmcC	Desulfohalobium retbaense DSM 5692 Gene: Dret_1029: Transmembrane complex, integral membrane protein	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0565: Transmembrane complex, integral membrane protein	Desulfovibrio desulfuricans G20 Gene: Dde_3708: Transmembrane complex, integral membrane protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_42510: Transmembrane complex, integral membrane protein	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_3042: Transmembrane complex, integral membrane protein	Desulfovibrio vulgaris Hildenborough Gene: DVU0265: Transmembrane complex, integral membrane protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2556: Transmembrane complex, integral membrane protein	Lawsonia intracellularis PHE/MN1-00	Transmembrane complex, integral membrane protein
tmcB	Desulfohalobium retbaense DSM 5692 Gene: Dret_1028: Transmembrane complex, ferredoxin, 2 [4Fe-4S]	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0566: Transmembrane complex, ferredoxin, 2 [4Fe-4S]	Desulfovibrio desulfuricans G20 Gene: Dde_3709: Transmembrane complex, ferredoxin, 2 [4Fe-4S]	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_42500: Transmembrane complex, ferredoxin, 2 [4Fe-4S]	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_3041: Transmembrane complex, ferredoxin, 2 [4Fe-4S]	Desulfovibrio vulgaris Hildenborough Gene: DVU0264: Transmembrane complex, ferredoxin, 2 [4Fe-4S]	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2555: Transmembrane complex, ferredoxin, 2 [4Fe-4S]	Lawsonia intracellularis PHE/MN1-00	Transmembrane complex, ferredoxin, 2 [4Fe-4S]
tmcA	Desulfohalobium retbaense DSM 5692 Gene: Dret_1027: cytochrome c class III	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0567: cytochrome c class III	Desulfovibrio desulfuricans G20 Gene: Dde_3710: cytochrome c class III	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_42490: cytochrome c class III	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_3040: cytochrome c class III	Desulfovibrio vulgaris Hildenborough Gene: DVU0263: cytochrome c class III	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2554: cytochrome c class III	Lawsonia intracellularis PHE/MN1-00	cytochrome c class III
Dde_3711	Desulfohalobium retbaense DSM 5692	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20 Gene: Dde_3711: hypothetical protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio vulgaris Hildenborough Gene: DVU0262: hypothetical protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2553: hypothetical protein	Lawsonia intracellularis PHE/MN1-00	hypothetical protein
DVU0261	Desulfohalobium retbaense DSM 5692 Gene: Dret_0871: Universal stress protein family	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0574: Universal stress protein family	Desulfovibrio desulfuricans G20 Gene: Dde_3712: Universal stress protein family	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_12890: Universal stress protein family	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1372: Universal stress protein family	Desulfovibrio vulgaris Hildenborough Gene: DVU0261: Universal stress protein family	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2552: Universal stress protein family	Lawsonia intracellularis PHE/MN1-00	Universal stress protein family
mtrA	Desulfohalobium retbaense DSM 5692 Gene: Dret_0870: response regulator receiver protein	Desulfomicrobium baculatum DSM 4028	Desulfovibrio desulfuricans G20 Gene: Dde_3713: response regulator receiver protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1371: response regulator receiver protein	Desulfovibrio vulgaris Hildenborough Gene: DVU0260: response regulator receiver protein	Desulfovibrio vulgaris str. Miyazaki F	Lawsonia intracellularis PHE/MN1-00	response regulator receiver protein
divK	Desulfohalobium retbaense DSM 5692 Gene: Dret_0869: response regulator receiver protein	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0575: response regulator receiver protein	Desulfovibrio desulfuricans G20 Gene: Dde_3714: response regulator receiver protein	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_12900: response regulator receiver protein	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1370: response regulator receiver protein	Desulfovibrio vulgaris Hildenborough Gene: DVU0259: response regulator receiver protein	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2551: response regulator receiver protein	Lawsonia intracellularis PHE/MN1-00	response regulator receiver protein
DVU0258	Desulfohalobium retbaense DSM 5692 Gene: Dret_0868: multi-sensor signal transduction histidine kinase	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_0576: multi-sensor signal transduction histidine kinase	Desulfovibrio desulfuricans G20 Gene: Dde_3715: multi-sensor signal transduction histidine kinase	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio magneticus RS-1 Gene: DMR_12910: multi-sensor signal transduction histidine kinase	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638 Gene: Desal_1369: multi-sensor signal transduction histidine kinase	Desulfovibrio vulgaris Hildenborough Gene: DVU0258: multi-sensor signal transduction histidine kinase	Desulfovibrio vulgaris str. Miyazaki F Gene: DvMF_2550: multi-sensor signal transduction histidine kinase	Lawsonia intracellularis PHE/MN1-00	multi-sensor signal transduction histidine kinase

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD