Regulon of TmcR in Desulfovibrio vulgaris str. Miyazaki F

Properties
Regulator type:	Transcription factor
TF locus tag:	DvMF_2547, DvMF_2546
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	TmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -195 Score: 5.7 Sequence: AACTATACCATTGCAGTATACAA Position: -170 Score: 6.1 Sequence: AAATCTACCACGCAAGTAGACTA Locus tag: DvMF_2557 Name: tmcD Funciton: hypothetical protein Locus tag: DvMF_2556 Name: tmcC Funciton: Transmembrane complex, integral membrane protein Locus tag: DvMF_2555 Name: tmcB Funciton: Transmembrane complex, ferredoxin, 2 [4Fe-4S] Locus tag: DvMF_2554 Name: tmcA Funciton: cytochrome c class III Locus tag: DvMF_2553 Name: null Funciton: hypothetical protein Locus tag: DvMF_2552 Name: null Funciton: Universal stress protein family Locus tag: DvMF_2551 Name: null Funciton: response regulator receiver protein Locus tag: DvMF_2550 Name: null Funciton: multi-sensor signal transduction histidine kinase
	DvMF_2557	tmcD	hypothetical protein
	DvMF_2556	tmcC	Transmembrane complex, integral membrane protein
	DvMF_2555	tmcB	Transmembrane complex, ferredoxin, 2 [4Fe-4S]
	DvMF_2554	tmcA	cytochrome c class III
	DvMF_2553		hypothetical protein
	DvMF_2552		Universal stress protein family
	DvMF_2551		response regulator receiver protein
	DvMF_2550		multi-sensor signal transduction histidine kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD