Regulon of TmcR in Desulfovibrio vulgaris Hildenborough

Properties
Regulator type:	Transcription factor
TF locus tag:	DVU0269
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	TmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -182 Score: 5.9 Sequence: TTGTCTACCATGACAGTAGTATT Locus tag: DVU0266 Name: tmcD Funciton: hypothetical protein Locus tag: DVU0265 Name: tmcC Funciton: Transmembrane complex, integral membrane protein Locus tag: DVU0264 Name: tmcB Funciton: Transmembrane complex, ferredoxin, 2 [4Fe-4S] Locus tag: DVU0263 Name: tmcA Funciton: cytochrome c class III Locus tag: DVU0262 Name: null Funciton: hypothetical protein Locus tag: DVU0261 Name: null Funciton: Universal stress protein family Locus tag: DVU0260 Name: mtrA Funciton: response regulator receiver protein Locus tag: DVU0259 Name: divK Funciton: response regulator receiver protein Locus tag: DVU0258 Name: null Funciton: multi-sensor signal transduction histidine kinase
	DVU0266	tmcD	hypothetical protein
	DVU0265	tmcC	Transmembrane complex, integral membrane protein
	DVU0264	tmcB	Transmembrane complex, ferredoxin, 2 [4Fe-4S]
	DVU0263	tmcA	cytochrome c class III
	DVU0262		hypothetical protein
	DVU0261		Universal stress protein family
	DVU0260	mtrA	response regulator receiver protein
	DVU0259	divK	response regulator receiver protein
	DVU0258		multi-sensor signal transduction histidine kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD