Regulon of TmcR in Desulfovibrio vulgaris Hildenborough
| Regulator type: | Transcription factor |
| TF locus tag: | DVU0269 |
| Regulator family: | Rrf2 |
| Regulation mode: | |
| Biological process: | Energy metabolism |
| Effector: | |
| Regulog: | TmcR - Desulfovibrionales |
| Statistics of regulated genes: | |
| - Genes | 9 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - Rrf2
- By pathway - Energy metabolism
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -182
Score: 5.9 Sequence: TTGTCTACCATGACAGTAGTATT
Locus tag: DVU0266
Name: tmcD Funciton: hypothetical protein
Locus tag: DVU0265
Name: tmcC Funciton: Transmembrane complex, integral membrane protein
Locus tag: DVU0264
Name: tmcB Funciton: Transmembrane complex, ferredoxin, 2 [4Fe-4S]
Locus tag: DVU0263
Name: tmcA Funciton: cytochrome c class III
Locus tag: DVU0262
Name: null Funciton: hypothetical protein
Locus tag: DVU0261
Name: null Funciton: Universal stress protein family
Locus tag: DVU0260
Name: mtrA Funciton: response regulator receiver protein
Locus tag: DVU0259
Name: divK Funciton: response regulator receiver protein
Locus tag: DVU0258
Name: null Funciton: multi-sensor signal transduction histidine kinase |
|||
|
tmcD
|
hypothetical protein
|
||
|
tmcC
|
Transmembrane complex, integral membrane protein
|
||
|
tmcB
|
Transmembrane complex, ferredoxin, 2 [4Fe-4S]
|
||
|
tmcA
|
cytochrome c class III
|
||
|
hypothetical protein
|
|||
|
Universal stress protein family
|
|||
|
mtrA
|
response regulator receiver protein
|
||
|
divK
|
response regulator receiver protein
|
||
|
multi-sensor signal transduction histidine kinase
|
|||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |