Regulon of TmcR in Desulfovibrio desulfuricans G20

Properties
Regulator type:	Transcription factor
TF locus tag:	Dde_3719
Regulator family:	Rrf2
Regulation mode:
Biological process:	Energy metabolism
Effector:
Regulog:	TmcR - Desulfovibrionales
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - Rrf2
By pathway - Energy metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -217 Score: 6.1 Sequence: TTCTATACCAAACAGGTATAGTA Position: -149 Score: 5.3 Sequence: TACTCCACCACTACAGTATAGTT Position: -83 Score: 5.8 Sequence: ATGTCTACCCAAAAGATAGAGTT Locus tag: Dde_3707 Name: tmcD Funciton: hypothetical protein Locus tag: Dde_3708 Name: tmcC Funciton: Transmembrane complex, integral membrane protein Locus tag: Dde_3709 Name: tmcB Funciton: Transmembrane complex, ferredoxin, 2 [4Fe-4S] Locus tag: Dde_3710 Name: tmcA Funciton: cytochrome c class III Locus tag: Dde_3711 Name: null Funciton: hypothetical protein Locus tag: Dde_3712 Name: null Funciton: Universal stress protein family Locus tag: Dde_3713 Name: mtrA Funciton: response regulator receiver protein Locus tag: Dde_3714 Name: divK Funciton: response regulator receiver protein Locus tag: Dde_3715 Name: null Funciton: multi-sensor signal transduction histidine kinase
	Dde_3707	tmcD	hypothetical protein
	Dde_3708	tmcC	Transmembrane complex, integral membrane protein
	Dde_3709	tmcB	Transmembrane complex, ferredoxin, 2 [4Fe-4S]
	Dde_3710	tmcA	cytochrome c class III
	Dde_3711		hypothetical protein
	Dde_3712		Universal stress protein family
	Dde_3713	mtrA	response regulator receiver protein
	Dde_3714	divK	response regulator receiver protein
	Dde_3715		multi-sensor signal transduction histidine kinase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD