Regulog RbsR - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Pseudomonas aeruginosa PAO1	5	1
Pseudomonas entomophila L48	7	1
Pseudomonas putida KT2440	7	1
Pseudomonas syringae pv. tomato str. DC3000	7	1
Pseudomonas fluorescens Pf-5	7	1
Pseudomonas mendocina ymp
Pseudomonas stutzeri A1501
Azotobacter vinelandii AvOP

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
rbsB	* Pseudomonas aeruginosa PAO1 Site: position = -76 score = 6.5259 sequence = TAACGCAAACGTTTGCGTCT Gene: PA1946: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	* Pseudomonas entomophila L48 Site: position = -52 score = 6.55293 sequence = CACCGCAAACGTTTGCGATC Gene: PSEEN1952: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	* Pseudomonas putida KT2440 Site: position = -53 score = 6.44527 sequence = CAACGCAAACGTTTGCTATC Gene: PP2454: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -84 score = 6.63194 sequence = CCTCGCAAACGTTTGCGTGT Gene: PSPTO2367: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	* Pseudomonas fluorescens Pf-5 Site: position = -140 score = 6.29544 sequence = TTACGCAAACGTTTGCGCGG Gene: PFL_2101: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsA	Pseudomonas aeruginosa PAO1 Gene: PA1947: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Pseudomonas entomophila L48 Gene: PSEEN1953: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Pseudomonas putida KT2440 Gene: PP2455: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2368: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Pseudomonas fluorescens Pf-5 Gene: PFL_2102: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC	Pseudomonas aeruginosa PAO1 Gene: PA1948: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Pseudomonas entomophila L48 Gene: PSEEN1954: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Pseudomonas putida KT2440 Gene: PP2456: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2369: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Pseudomonas fluorescens Pf-5 Gene: PFL_2103: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsR	Pseudomonas aeruginosa PAO1 Gene: PA1949: Transcriptional repressor of ribose utilization, LacI family	Pseudomonas entomophila L48 Gene: PSEEN1955: Transcriptional repressor of ribose utilization, LacI family	Pseudomonas putida KT2440 Gene: PP2457: Transcriptional repressor of ribose utilization, LacI family	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2370: Transcriptional repressor of ribose utilization, LacI family	Pseudomonas fluorescens Pf-5 Gene: PFL_2104: Transcriptional repressor of ribose utilization, LacI family	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Transcriptional repressor of ribose utilization, LacI family
rbsK	Pseudomonas aeruginosa PAO1 Gene: PA1950: Ribokinase (EC 2.7.1.15)	Pseudomonas entomophila L48 Gene: PSEEN1956: Ribokinase (EC 2.7.1.15)	Pseudomonas putida KT2440 Gene: PP2458: Ribokinase (EC 2.7.1.15)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2371: Ribokinase (EC 2.7.1.15)	Pseudomonas fluorescens Pf-5 Gene: PFL_2105: Ribokinase (EC 2.7.1.15)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Ribokinase (EC 2.7.1.15)
rbsD	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48 Gene: PSEEN1957: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Pseudomonas putida KT2440 Gene: PP2459: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2372: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Pseudomonas fluorescens Pf-5 Gene: PFL_2106: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
uriH	Pseudomonas aeruginosa PAO1 Gene: PA0143: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)	Pseudomonas entomophila L48 Gene: PSEEN1958: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)	Pseudomonas putida KT2440 Gene: PP2460: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO2373: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)	Pseudomonas fluorescens Pf-5 Gene: PFL_2107: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)	Pseudomonas mendocina ymp	Pseudomonas stutzeri A1501	Azotobacter vinelandii AvOP	Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --