Regulog RbsR - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RbsR
- By taxonomy - Pseudomonadaceae
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Pseudomonas aeruginosa PAO1 | 5 | 1 |
| Pseudomonas entomophila L48 | 7 | 1 |
| Pseudomonas putida KT2440 | 7 | 1 |
| Pseudomonas syringae pv. tomato str. DC3000 | 7 | 1 |
| Pseudomonas fluorescens Pf-5 | 7 | 1 |
| Pseudomonas mendocina ymp | ||
| Pseudomonas stutzeri A1501 | ||
| Azotobacter vinelandii AvOP |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| rbsB |
*
Pseudomonas aeruginosa PAO1 Site: position = -76 score = 6.5259 sequence = TAACGCAAACGTTTGCGTCT Gene: PA1946: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
*
Pseudomonas entomophila L48 Site: position = -52 score = 6.55293 sequence = CACCGCAAACGTTTGCGATC Gene: PSEEN1952: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
*
Pseudomonas putida KT2440 Site: position = -53 score = 6.44527 sequence = CAACGCAAACGTTTGCTATC Gene: PP2454: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -84 score = 6.63194 sequence = CCTCGCAAACGTTTGCGTGT Gene: PSPTO2367: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
*
Pseudomonas fluorescens Pf-5 Site: position = -140 score = 6.29544 sequence = TTACGCAAACGTTTGCGCGG Gene: PFL_2101: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
|
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsA |
Gene: PA1947: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: PSEEN1953: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: PP2455: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: PSPTO2368: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: PFL_2102: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
|
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
Gene: PA1948: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: PSEEN1954: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: PP2456: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: PSPTO2369: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: PFL_2103: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
|
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsR |
Gene: PA1949: Transcriptional repressor of ribose utilization, LacI family |
Gene: PSEEN1955: Transcriptional repressor of ribose utilization, LacI family |
Gene: PP2457: Transcriptional repressor of ribose utilization, LacI family |
Gene: PSPTO2370: Transcriptional repressor of ribose utilization, LacI family |
Gene: PFL_2104: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
Transcriptional repressor of ribose utilization, LacI family |
| rbsK |
Gene: PA1950: Ribokinase (EC 2.7.1.15) |
Gene: PSEEN1956: Ribokinase (EC 2.7.1.15) |
Gene: PP2458: Ribokinase (EC 2.7.1.15) |
Gene: PSPTO2371: Ribokinase (EC 2.7.1.15) |
Gene: PFL_2105: Ribokinase (EC 2.7.1.15) |
|
|
|
Ribokinase (EC 2.7.1.15) |
| rbsD |
|
Gene: PSEEN1957: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: PP2459: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: PSPTO2372: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: PFL_2106: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| uriH |
Gene: PA0143: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
Gene: PSEEN1958: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
Gene: PP2460: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
Gene: PSPTO2373: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
Gene: PFL_2107: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
|
|
|
Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |