Regulon of RbsR in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_2104
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -140 Score: 6.3 Sequence: TTACGCAAACGTTTGCGCGG Locus tag: PFL_2101 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: PFL_2102 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: PFL_2103 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: PFL_2104 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: PFL_2105 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: PFL_2106 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: PFL_2107 Name: uriH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
	PFL_2101	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	PFL_2102	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	PFL_2103	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	PFL_2104	rbsR	Transcriptional repressor of ribose utilization, LacI family
	PFL_2105	rbsK	Ribokinase (EC 2.7.1.15)
	PFL_2106	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	PFL_2107	uriH	Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD