Regulon of RbsR in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP2457
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -53 Score: 6.4 Sequence: CAACGCAAACGTTTGCTATC Locus tag: PP2454 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: PP2455 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: PP2456 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: PP2457 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: PP2458 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: PP2459 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: PP2460 Name: uriH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
	PP2454	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	PP2455	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	PP2456	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	PP2457	rbsR	Transcriptional repressor of ribose utilization, LacI family
	PP2458	rbsK	Ribokinase (EC 2.7.1.15)
	PP2459	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	PP2460	uriH	Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD