Regulon of RbsR in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO2370
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Pseudomonadaceae
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Pseudomonadaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 6.6 Sequence: CCTCGCAAACGTTTGCGTGT Locus tag: PSPTO2367 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: PSPTO2368 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: PSPTO2369 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: PSPTO2370 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: PSPTO2371 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: PSPTO2372 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: PSPTO2373 Name: uriH Funciton: Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)
	PSPTO2367	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	PSPTO2368	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	PSPTO2369	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	PSPTO2370	rbsR	Transcriptional repressor of ribose utilization, LacI family
	PSPTO2371	rbsK	Ribokinase (EC 2.7.1.15)
	PSPTO2372	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	PSPTO2373	uriH	Inosine-uridine preferring nucleoside hydrolase (EC 3.2.2.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD