Regulog RbsR - Psychromonadaceae/Aeromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Psychromonas ingrahamii 37	6	1
Psychromonas sp. CNPT3	6	1
Moritella sp. PE36	6	1
Aeromonas hydrophila subsp. hydrophila ATCC 7966	6	1
Aeromonas salmonicida subsp. salmonicida A449	1	1
Tolumonas auensis DSM 9187	6	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
rbsD	* Psychromonas ingrahamii 37 Site: position = -107 score = 5.60385 sequence = CCATCGAAACGTTTGCGCAA Gene: Ping_0340: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Psychromonas sp. CNPT3 Site: position = -94 score = 5.72743 sequence = TTATCGAAACGTTTGCGCAA Site: position = -82 score = 5.60385 sequence = TTGCGCAAACGTTTCGATGG Gene: PCNPT3_07068: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Moritella sp. PE36 Site: position = -82 score = 5.60385 sequence = TTGCGCAAACGTTTCGATGG Site: position = -94 score = 5.60385 sequence = CCATCGAAACGTTTGCGCAA Gene: PE36_05828: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -72 score = 5.42914 sequence = TGACGCAACCGGTTGCGTAA Gene: AHA_2309: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Aeromonas salmonicida subsp. salmonicida A449 Site: position = -75 score = 5.42914 sequence = TGACGCAACCGGTTGCGTAA Gene: ASA_1971: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	2 Tolumonas auensis DSM 9187* Site: position = -139 score = 5.48485 sequence = CCATCGAAACGTTTCGATGG Gene: Tola_0571: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Gene: Tola_0569: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA	Psychromonas ingrahamii 37 Gene: Ping_0341: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Psychromonas sp. CNPT3 Gene: PCNPT3_07073: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Moritella sp. PE36 Gene: PE36_05823: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_2310: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Aeromonas salmonicida subsp. salmonicida A449	Tolumonas auensis DSM 9187 Gene: Tola_0572: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC	Psychromonas ingrahamii 37 Gene: Ping_0342: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Psychromonas sp. CNPT3 Gene: PCNPT3_07078: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Moritella sp. PE36 Gene: PE36_05818: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_2311: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_1969: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Tolumonas auensis DSM 9187 Gene: Tola_0573: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB	Psychromonas ingrahamii 37 Gene: Ping_0343: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Psychromonas sp. CNPT3 Gene: PCNPT3_07083: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Moritella sp. PE36 Gene: PE36_05813: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_2312: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_1968: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Tolumonas auensis DSM 9187 Gene: Tola_0574: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK	Psychromonas ingrahamii 37 Gene: Ping_0344: Ribokinase (EC 2.7.1.15)	Psychromonas sp. CNPT3 Gene: PCNPT3_07088: Ribokinase (EC 2.7.1.15)	Moritella sp. PE36 Gene: PE36_05808: Ribokinase (EC 2.7.1.15)	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_2313: Ribokinase (EC 2.7.1.15)	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_1967: Ribokinase (EC 2.7.1.15)	2 Tolumonas auensis DSM 9187 Gene: Tola_0575: Ribokinase (EC 2.7.1.15) Gene: Tola_0570: Ribokinase (EC 2.7.1.15)	Ribokinase (EC 2.7.1.15)
rbsR	Psychromonas ingrahamii 37 Gene: Ping_0345: Transcriptional repressor of ribose utilization, LacI family	Psychromonas sp. CNPT3 Gene: PCNPT3_07093: Transcriptional repressor of ribose utilization, LacI family	Moritella sp. PE36 Gene: PE36_05803: Transcriptional repressor of ribose utilization, LacI family	Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_2314: Transcriptional repressor of ribose utilization, LacI family	Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_1966: Transcriptional repressor of ribose utilization, LacI family	Tolumonas auensis DSM 9187 Gene: Tola_0576: Transcriptional repressor of ribose utilization, LacI family	Transcriptional repressor of ribose utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Psychromonadaceae/Aeromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --