Regulog RbsR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 6 | 1 |
| Psychromonas sp. CNPT3 | 6 | 1 |
| Moritella sp. PE36 | 6 | 1 |
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | 6 | 1 |
| Aeromonas salmonicida subsp. salmonicida A449 | 1 | 1 |
| Tolumonas auensis DSM 9187 | 6 | 1 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| rbsD |
*
Psychromonas ingrahamii 37 Site: position = -107 score = 5.60385 sequence = CCATCGAAACGTTTGCGCAA Gene: Ping_0340: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Psychromonas sp. CNPT3 Site: position = -94 score = 5.72743 sequence = TTATCGAAACGTTTGCGCAA Site: position = -82 score = 5.60385 sequence = TTGCGCAAACGTTTCGATGG Gene: PCNPT3_07068: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Moritella sp. PE36 Site: position = -82 score = 5.60385 sequence = TTGCGCAAACGTTTCGATGG Site: position = -94 score = 5.60385 sequence = CCATCGAAACGTTTGCGCAA Gene: PE36_05828: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Site: position = -72 score = 5.42914 sequence = TGACGCAACCGGTTGCGTAA Gene: AHA_2309: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Aeromonas salmonicida subsp. salmonicida A449 Site: position = -75 score = 5.42914 sequence = TGACGCAACCGGTTGCGTAA Gene: ASA_1971: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*2
Tolumonas auensis DSM 9187 Site: position = -139 score = 5.48485 sequence = CCATCGAAACGTTTCGATGG Gene: Tola_0571: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Gene: Tola_0569: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
Gene: Ping_0341: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: PCNPT3_07073: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: PE36_05823: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: AHA_2310: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
Gene: Tola_0572: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
Gene: Ping_0342: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: PCNPT3_07078: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: PE36_05818: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: AHA_2311: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: ASA_1969: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: Tola_0573: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
Gene: Ping_0343: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: PCNPT3_07083: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: PE36_05813: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: AHA_2312: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: ASA_1968: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: Tola_0574: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsK |
Gene: Ping_0344: Ribokinase (EC 2.7.1.15) |
Gene: PCNPT3_07088: Ribokinase (EC 2.7.1.15) |
Gene: PE36_05808: Ribokinase (EC 2.7.1.15) |
Gene: AHA_2313: Ribokinase (EC 2.7.1.15) |
Gene: ASA_1967: Ribokinase (EC 2.7.1.15) |
2
Tolumonas auensis DSM 9187 Gene: Tola_0575: Ribokinase (EC 2.7.1.15) Gene: Tola_0570: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsR |
Gene: Ping_0345: Transcriptional repressor of ribose utilization, LacI family |
Gene: PCNPT3_07093: Transcriptional repressor of ribose utilization, LacI family |
Gene: PE36_05803: Transcriptional repressor of ribose utilization, LacI family |
Gene: AHA_2314: Transcriptional repressor of ribose utilization, LacI family |
Gene: ASA_1966: Transcriptional repressor of ribose utilization, LacI family |
Gene: Tola_0576: Transcriptional repressor of ribose utilization, LacI family |
Transcriptional repressor of ribose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |