Regulon of RbsR in Aeromonas salmonicida subsp. salmonicida A449
| Regulator type: | Transcription factor |
| TF locus tag: | ASA_1966 |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Regulog: | RbsR - Psychromonadaceae/Aeromonadales |
| Statistics of regulated genes: | |
| - Genes | 1 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -75
Score: 5.4 Sequence: TGACGCAACCGGTTGCGTAA
Locus tag: ASA_1971
Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|||
|
rbsD
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |