Regulon of RbsR in Moritella sp. PE36

Properties
Regulator type:	Transcription factor
TF locus tag:	PE36_05803
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -94 Score: 5.6 Sequence: CCATCGAAACGTTTGCGCAA Position: -82 Score: 5.6 Sequence: TTGCGCAAACGTTTCGATGG Locus tag: PE36_05828 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: PE36_05823 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: PE36_05818 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: PE36_05813 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: PE36_05808 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: PE36_05803 Name: rbsR Funciton: Transcriptional repressor of ribose utilization, LacI family
	PE36_05828	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	PE36_05823	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	PE36_05818	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	PE36_05813	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	PE36_05808	rbsK	Ribokinase (EC 2.7.1.15)
	PE36_05803	rbsR	Transcriptional repressor of ribose utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD