Regulog RbsR - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RbsR
- By taxonomy - Vibrionales
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | 6 | 1 |
| Vibrio vulnificus CMCP6 | 6 | 1 |
| Vibrio harveyi ATCC BAA-1116 | 6 | 1 |
| Vibrio parahaemolyticus RIMD 2210633 | 6 | 1 |
| Vibrio shilonii AK1 | 6 | 1 |
| Vibrio splendidus LGP32 | 6 | 1 |
| Vibrio fischeri ES114 | 6 | 1 |
| Vibrio salmonicida LFI1238 | 6 | 1 |
| Vibrio angustum S14 | 6 | 1 |
| Photobacterium profundum SS9 | 6 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| rbsD |
*
Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -86 score = 6.98537 sequence = TCATCGAAACGTTTCGATGT Gene: VCA0127: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio vulnificus CMCP6 Site: position = -72 score = 7.17982 sequence = TCATCGAAACGTTTCGATGA Gene: VV20061: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio harveyi ATCC BAA-1116 Site: position = -222 score = 6.18918 sequence = CTATCGAAACGTTTCGATTT Site: position = -95 score = 6.98537 sequence = TCATCGAAACGTTTCGATGT Gene: VIBHAR_06146: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio parahaemolyticus RIMD 2210633 Site: position = -226 score = 7.04507 sequence = CCATCGAAACGTTTCGATGA Site: position = -96 score = 6.69483 sequence = GCATCGAAACGTTTCGATGA Gene: VPA1087: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio shilonii AK1 Site: position = -170 score = 6.56707 sequence = TCATCGAAACGTTTCGATAG Site: position = -87 score = 7.17982 sequence = TCATCGAAACGTTTCGATGA Gene: VSAK1_16182: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio splendidus LGP32 Site: position = -26 score = 6.62481 sequence = CTATCGAAACGTTTCGATGG Site: position = -104 score = 7.04507 sequence = CCATCGAAACGTTTCGATGA Gene: VS_II0940: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio fischeri ES114 Site: position = -71 score = 6.39547 sequence = TTACGCAAACGTTTCGATGA Gene: VF_1444: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio salmonicida LFI1238 Site: position = -70 score = 6.39547 sequence = TTACGCAAACGTTTCGATGA Gene: VSAL_I1372: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Vibrio angustum S14 Site: position = -226 score = 6.75955 sequence = TTATCGAAACGTTTCGATGG Site: position = -96 score = 6.62481 sequence = CTATCGAAACGTTTCGATGG Gene: VAS14_09005: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Photobacterium profundum SS9 Site: position = -118 score = 5.73617 sequence = CCATCGAAACGTTTGCGTAA Gene: PBPRB1556: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
Gene: VCA0128: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VV20062: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VIBHAR_06145: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VPA1086: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VSAK1_16177: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VS_II0941: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VF_1445: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VSAL_I1371: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: VAS14_09010: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: PBPRB1557: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
Gene: VCA0129: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VV20063: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VIBHAR_06144: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VPA1085: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VSAK1_16172: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VS_II0942: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VF_1446: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VSAL_I1370: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: VAS14_09015: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: PBPRB1558: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
Gene: VCA0130: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VV20064: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VIBHAR_06143: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VPA1084: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VSAK1_16167: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VS_II0943: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VF_1447: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VSAL_I1369: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: VAS14_09020: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: PBPRB1559: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsK |
Gene: VCA0131: Ribokinase (EC 2.7.1.15) |
Gene: VV20065: Ribokinase (EC 2.7.1.15) |
Gene: VIBHAR_06142: Ribokinase (EC 2.7.1.15) |
Gene: VPA1083: Ribokinase (EC 2.7.1.15) |
Gene: VSAK1_16162: Ribokinase (EC 2.7.1.15) |
Gene: VS_II0944: Ribokinase (EC 2.7.1.15) |
Gene: VF_1448: Ribokinase (EC 2.7.1.15) |
Gene: VSAL_I1368: Ribokinase (EC 2.7.1.15) |
Gene: VAS14_09025: Ribokinase (EC 2.7.1.15) |
Gene: PBPRB1560: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsR |
Gene: VCA0132: Transcriptional repressor of ribose utilization, LacI family |
Gene: VV20066: Transcriptional repressor of ribose utilization, LacI family |
Gene: VIBHAR_06141: Transcriptional repressor of ribose utilization, LacI family |
Gene: VPA1082: Transcriptional repressor of ribose utilization, LacI family |
Gene: VSAK1_16157: Transcriptional repressor of ribose utilization, LacI family |
Gene: VS_II0945: Transcriptional repressor of ribose utilization, LacI family |
Gene: VF_1449: Transcriptional repressor of ribose utilization, LacI family |
Gene: VSAL_I1367: Transcriptional repressor of ribose utilization, LacI family |
Gene: VAS14_09030: Transcriptional repressor of ribose utilization, LacI family |
Gene: PBPRB1561: Transcriptional repressor of ribose utilization, LacI family |
Transcriptional repressor of ribose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |