Regulog RbsR - Vibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By trascription factor - RbsR
By taxonomy - Vibrionales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Statistics of regulated genes
Genome	Genes	Operons
Vibrio cholerae O1 biovar eltor str. N16961	6	1
Vibrio vulnificus CMCP6	6	1
Vibrio harveyi ATCC BAA-1116	6	1
Vibrio parahaemolyticus RIMD 2210633	6	1
Vibrio shilonii AK1	6	1
Vibrio splendidus LGP32	6	1
Vibrio fischeri ES114	6	1
Vibrio salmonicida LFI1238	6	1
Vibrio angustum S14	6	1
Photobacterium profundum SS9	6	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
rbsD	* Vibrio cholerae O1 biovar eltor str. N16961 Site: position = -86 score = 6.98537 sequence = TCATCGAAACGTTTCGATGT Gene: VCA0127: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio vulnificus CMCP6 Site: position = -72 score = 7.17982 sequence = TCATCGAAACGTTTCGATGA Gene: VV20061: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio harveyi ATCC BAA-1116 Site: position = -222 score = 6.18918 sequence = CTATCGAAACGTTTCGATTT Site: position = -95 score = 6.98537 sequence = TCATCGAAACGTTTCGATGT Gene: VIBHAR_06146: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio parahaemolyticus RIMD 2210633 Site: position = -226 score = 7.04507 sequence = CCATCGAAACGTTTCGATGA Site: position = -96 score = 6.69483 sequence = GCATCGAAACGTTTCGATGA Gene: VPA1087: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio shilonii AK1 Site: position = -170 score = 6.56707 sequence = TCATCGAAACGTTTCGATAG Site: position = -87 score = 7.17982 sequence = TCATCGAAACGTTTCGATGA Gene: VSAK1_16182: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio splendidus LGP32 Site: position = -26 score = 6.62481 sequence = CTATCGAAACGTTTCGATGG Site: position = -104 score = 7.04507 sequence = CCATCGAAACGTTTCGATGA Gene: VS_II0940: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio fischeri ES114 Site: position = -71 score = 6.39547 sequence = TTACGCAAACGTTTCGATGA Gene: VF_1444: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio salmonicida LFI1238 Site: position = -70 score = 6.39547 sequence = TTACGCAAACGTTTCGATGA Gene: VSAL_I1372: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Vibrio angustum S14 Site: position = -226 score = 6.75955 sequence = TTATCGAAACGTTTCGATGG Site: position = -96 score = 6.62481 sequence = CTATCGAAACGTTTCGATGG Gene: VAS14_09005: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	* Photobacterium profundum SS9 Site: position = -118 score = 5.73617 sequence = CCATCGAAACGTTTGCGTAA Gene: PBPRB1556: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0128: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio vulnificus CMCP6 Gene: VV20062: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06145: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1086: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio shilonii AK1 Gene: VSAK1_16177: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio splendidus LGP32 Gene: VS_II0941: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio fischeri ES114 Gene: VF_1445: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio salmonicida LFI1238 Gene: VSAL_I1371: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Vibrio angustum S14 Gene: VAS14_09010: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Photobacterium profundum SS9 Gene: PBPRB1557: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0129: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio vulnificus CMCP6 Gene: VV20063: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06144: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1085: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio shilonii AK1 Gene: VSAK1_16172: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio splendidus LGP32 Gene: VS_II0942: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio fischeri ES114 Gene: VF_1446: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio salmonicida LFI1238 Gene: VSAL_I1370: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Vibrio angustum S14 Gene: VAS14_09015: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Photobacterium profundum SS9 Gene: PBPRB1558: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0130: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio vulnificus CMCP6 Gene: VV20064: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06143: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1084: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio shilonii AK1 Gene: VSAK1_16167: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio splendidus LGP32 Gene: VS_II0943: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio fischeri ES114 Gene: VF_1447: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio salmonicida LFI1238 Gene: VSAL_I1369: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Vibrio angustum S14 Gene: VAS14_09020: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Photobacterium profundum SS9 Gene: PBPRB1559: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
rbsK	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0131: Ribokinase (EC 2.7.1.15)	Vibrio vulnificus CMCP6 Gene: VV20065: Ribokinase (EC 2.7.1.15)	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06142: Ribokinase (EC 2.7.1.15)	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1083: Ribokinase (EC 2.7.1.15)	Vibrio shilonii AK1 Gene: VSAK1_16162: Ribokinase (EC 2.7.1.15)	Vibrio splendidus LGP32 Gene: VS_II0944: Ribokinase (EC 2.7.1.15)	Vibrio fischeri ES114 Gene: VF_1448: Ribokinase (EC 2.7.1.15)	Vibrio salmonicida LFI1238 Gene: VSAL_I1368: Ribokinase (EC 2.7.1.15)	Vibrio angustum S14 Gene: VAS14_09025: Ribokinase (EC 2.7.1.15)	Photobacterium profundum SS9 Gene: PBPRB1560: Ribokinase (EC 2.7.1.15)	Ribokinase (EC 2.7.1.15)
rbsR	Vibrio cholerae O1 biovar eltor str. N16961 Gene: VCA0132: Transcriptional repressor of ribose utilization, LacI family	Vibrio vulnificus CMCP6 Gene: VV20066: Transcriptional repressor of ribose utilization, LacI family	Vibrio harveyi ATCC BAA-1116 Gene: VIBHAR_06141: Transcriptional repressor of ribose utilization, LacI family	Vibrio parahaemolyticus RIMD 2210633 Gene: VPA1082: Transcriptional repressor of ribose utilization, LacI family	Vibrio shilonii AK1 Gene: VSAK1_16157: Transcriptional repressor of ribose utilization, LacI family	Vibrio splendidus LGP32 Gene: VS_II0945: Transcriptional repressor of ribose utilization, LacI family	Vibrio fischeri ES114 Gene: VF_1449: Transcriptional repressor of ribose utilization, LacI family	Vibrio salmonicida LFI1238 Gene: VSAL_I1367: Transcriptional repressor of ribose utilization, LacI family	Vibrio angustum S14 Gene: VAS14_09030: Transcriptional repressor of ribose utilization, LacI family	Photobacterium profundum SS9 Gene: PBPRB1561: Transcriptional repressor of ribose utilization, LacI family	Transcriptional repressor of ribose utilization, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RbsR - Vibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --